Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010114 Mycobacterium avium subsp. paratuberculosis strain E93 chromosome, complete genome 9 crisprs DinG,csa3,cas4,WYL,cas3,DEDDh 2 5 1 0

Results visualization

1. NZ_CP010114
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_1 401817-401907 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_2 1078254-1078334 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_3 1107443-1107533 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_4 1281932-1282009 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_5 2033852-2033953 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_6 2248733-2248839 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_7 2322129-2322227 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_8 2991691-2991771 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010114_9 4598694-4598801 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP010114.1 348080-348108 0 1.0
NZ_CP010114_9 9.1|4598718|18|NZ_CP010114|CRISPRCasFinder 4598718-4598735 18 NZ_CP010114.1 3982544-3982561 0 1.0
NZ_CP010114_9 9.1|4598718|18|NZ_CP010114|CRISPRCasFinder 4598718-4598735 18 NZ_CP010114.1 2248674-2248691 1 0.944

1. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to position: 348080-348108, mismatch: 0, identity: 1.0 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cggctgcgccgcgcttgcgatcgccgcgc	Protospacer
*****************************

2. spacer 9.1|4598718|18|NZ_CP010114|CRISPRCasFinder matches to position: 3982544-3982561, mismatch: 0, identity: 1.0 

cgccggccaagaaggcac	CRISPR spacer
cgccggccaagaaggcac	Protospacer
******************

3. spacer 9.1|4598718|18|NZ_CP010114|CRISPRCasFinder matches to position: 2248674-2248691, mismatch: 1, identity: 0.944 

cgccggccaagaaggcac	CRISPR spacer
cgctggccaagaaggcac	Protospacer
***.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 492097-492125 3 0.897
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 509638-509666 3 0.897
NZ_CP010114_6 6.1|2248774|25|NZ_CP010114|CRISPRCasFinder 2248774-2248798 25 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 141033-141057 3 0.88
NZ_CP010114_1 1.1|401850|25|NZ_CP010114|CRISPRCasFinder 401850-401874 25 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 131283-131307 4 0.84
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 251834-251862 4 0.862
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1780240-1780268 4 0.862
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1847066-1847094 4 0.862
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 1027719-1027747 4 0.862
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 23039-23067 4 0.862
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_014811 Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence 179192-179220 4 0.862
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 44679-44707 4 0.862
NZ_CP010114_6 6.1|2248774|25|NZ_CP010114|CRISPRCasFinder 2248774-2248798 25 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 106673-106697 4 0.84
NZ_CP010114_6 6.1|2248774|25|NZ_CP010114|CRISPRCasFinder 2248774-2248798 25 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 938214-938238 4 0.84
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP022747 Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence 83563-83591 5 0.828
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP022749 Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence 166742-166770 5 0.828
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 523304-523332 5 0.828
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 MH744420 Streptomyces phage Kromp, complete genome 13856-13884 5 0.828
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 110271-110300 5 0.833
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP015742 Shinella sp. HZN7 plasmid pShin-06, complete sequence 109265-109294 5 0.833
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 145172-145200 6 0.793
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP012708 Psychrobacter urativorans strain R310.10B plasmid 2, complete sequence 936-964 6 0.793
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 99913-99941 6 0.793
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 331027-331055 6 0.793
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 79911-79940 6 0.8
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1388616-1388645 6 0.8
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 151699-151728 6 0.8
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 72517-72546 6 0.8
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 92492-92520 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2090622-2090650 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 16376-16404 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 597057-597085 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 542873-542901 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 708548-708576 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_021911 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence 418198-418226 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 566904-566932 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 34546-34574 7 0.759
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 11428-11456 7 0.759
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 125440-125469 7 0.767
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 576541-576570 7 0.767
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NC_013193 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence 107046-107075 7 0.767
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 517672-517701 7 0.767
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 MT657333 Microbacterium phage Casend, complete genome 60372-60401 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 633098-633127 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_007491 Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence 186714-186743 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 860496-860525 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 105298-105327 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 952629-952658 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 630927-630956 7 0.767
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP042333 Bosea sp. F3-2 plasmid pB32-2, complete sequence 139030-139059 7 0.767
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 589152-589180 8 0.724
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 719122-719150 8 0.724
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 339852-339880 8 0.724
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 539184-539212 8 0.724
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 597600-597628 8 0.724
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP006257 Pseudomonas syringae pv. syringae HS191 plasmid unnamed, complete sequence 7119-7147 8 0.724
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 MH632120 Mycobacterium phage Thonko, complete genome 52304-52332 8 0.724
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4993432-4993461 8 0.733
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 34530-34559 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 279753-279782 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 680929-680958 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 24127-24156 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 107044-107073 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 582842-582871 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN234205 Mycobacterium phage Veliki, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MH727544 Mycobacterium phage Dalmuri, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 JF704105 Mycobacterium phage Adephagia, complete sequence 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN234198 Mycobacterium phage Zavala, complete genome 275-304 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MF140412 Mycobacterium phage Jeckyll, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 KY380102 Mycobacterium phage CREW, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 KX585253 Mycobacterium phage HedwigODU, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN234230 Mycobacterium phage Atiba, complete genome 275-304 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MF140430 Mycobacterium phage Tachez, complete genome 275-304 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MF140428 Mycobacterium phage Slimphazie, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MK460247 Mycobacterium phage YoureAdopted, complete genome 275-304 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN234231 Mycobacterium phage Rapunzel97, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN908692 Mycobacterium Phage BGlluviae, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_023747 Mycobacterium phage BarrelRoll, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_042031 Mycobacterium phage Anaya, complete sequence 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MH536821 Mycobacterium phage Homura, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MF668267 Mycobacterium phage Apocalypse, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MH697578 Mycobacterium phage Belladonna, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MH509444 Mycobacterium phage BEEST, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN369742 Mycobacterium phage Spock, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MK112537 Mycobacterium Phage Capricorn, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN369746 Mycobacterium phage Inky, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MH051246 Mycobacterium phage ActinUp, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN234197 Mycobacterium phage Ramen, complete genome 299-328 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP015523 Sphingomonas sp. NIC1 plasmid unnamed2, complete sequence 167289-167318 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 782258-782287 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP049735 Rhizobium leguminosarum strain A1 plasmid unnamed2, complete sequence 10604-10633 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 449800-449829 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 16045-16074 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1614565-1614594 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 184540-184569 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 379461-379490 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 CP049735 Rhizobium leguminosarum strain A1 plasmid pRLa12, complete sequence 22247-22276 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 303528-303557 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 988000-988029 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 376671-376700 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 539910-539939 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 789851-789880 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 546169-546198 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1144377-1144406 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 351526-351555 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 MN096355 Mycobacterium phage Purky, complete genome 4764-4793 8 0.733
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 HQ332141 Halorubrum phage CGphi46 genomic sequence 23584-23613 8 0.733
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 132707-132736 9 0.7
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 326083-326112 9 0.7
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1583679-1583708 9 0.7
NZ_CP010114_4 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder 1281956-1281985 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 369234-369263 9 0.7
NZ_CP010114_5 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder 2033888-2033917 30 NZ_LR134466 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence 68964-68993 9 0.7
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 187322-187350 10 0.655
NZ_CP010114_2 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder 1078280-1078308 29 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 1138221-1138249 10 0.655

1. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.897 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cggctgcgccgcgcttgcgatcgcctcta	Protospacer
************************* *

2. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.897 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cggctgcgccgcgcttgcgatcgcctcta	Protospacer
************************* *

3. spacer 6.1|2248774|25|NZ_CP010114|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.88 

ggccgtgctggccaattcgcggccg	CRISPR spacer
cgccgagctggccaattcgcggcag	Protospacer
 **** ***************** *

4. spacer 1.1|401850|25|NZ_CP010114|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 4, identity: 0.84 

gggtgggatggcccgcctcctcctc	CRISPR spacer
ctatgggatggcccgcctcctcttc	Protospacer
  .*******************.**

5. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 4, identity: 0.862 

--cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gtcgg--gcgcggcgctggcgatcgccgcgc	Protospacer
  ***  **** ***** *************

6. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.862 

cggctg-cgccgcgcttgcgatcgccgcgc	CRISPR spacer
-ggccgttgccgcgctggcgatcgccgcgc	Protospacer
 ***.* .******** *************

7. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 4, identity: 0.862 

cggctg-cgccgcgcttgcgatcgccgcgc	CRISPR spacer
-ggccgttgccgcgctggcgatcgccgcgc	Protospacer
 ***.* .******** *************

8. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 4, identity: 0.862 

cggctgcgccgcgcttgcgatc-gccgcgc	CRISPR spacer
gggctgcgccccgcttgcgatcggccgag-	Protospacer
 ********* *********** **** *

9. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 4, identity: 0.862 

cggctg--cgccgcgcttgcgatcgccgcgc	CRISPR spacer
--gctggccgccgcgcgtgcgatggccgcgc	Protospacer
  ****  ******** ****** *******

10. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 4, identity: 0.862 

cggctg--cgccgcgcttgcgatcgccgcgc	CRISPR spacer
--gctggccgccgcgcgtgcgatggccgcgc	Protospacer
  ****  ******** ****** *******

11. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 4, identity: 0.862 

cggctg--cgccgcgcttgcgatcgccgcgc	CRISPR spacer
--gctggccgccgcgcgtgcgatggccgcgc	Protospacer
  ****  ******** ****** *******

12. spacer 6.1|2248774|25|NZ_CP010114|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 4, identity: 0.84 

ggccgtgctggccaattcgcggccg	CRISPR spacer
ggccgtgctggacaattcgcggtgc	Protospacer
*********** **********.

13. spacer 6.1|2248774|25|NZ_CP010114|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.84 

ggccgtgctggccaattcgcggccg	CRISPR spacer
ggccgcgctggccatttcgcggcga	Protospacer
*****.******** ******** .

14. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gggcggcgccgcgattgcgatcgccggga	Protospacer
 *** ******** ************ *

15. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP022749 (Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.828 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gggcggcgccgcgattgcgatcgccggga	Protospacer
 *** ******** ************ *

16. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 5, identity: 0.828 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cgcctgcgccgggcttgcgatcgcattgc	Protospacer
** ******** ************  .**

17. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to MH744420 (Streptomyces phage Kromp, complete genome) position: , mismatch: 5, identity: 0.828 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cgccgacgccgcggtggcgatcgccgcgc	Protospacer
** * .******* * *************

18. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

---acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
ccgccgggc---gcgtgacgctcgacggccgcg	Protospacer
    *****   **************** ****

19. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP015742 (Shinella sp. HZN7 plasmid pShin-06, complete sequence) position: , mismatch: 5, identity: 0.833 

acgggcgcggcgtgacgctcgacgggcgcg-	CRISPR spacer
acgtgcgcggcgtgacgctcggc-tacgcgc	Protospacer
*** *****************.*  .****

20. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 6, identity: 0.793 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
ctgatgcgccacgcttgcgatcgccgaaa	Protospacer
* * ******.*************** .

21. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP012708 (Psychrobacter urativorans strain R310.10B plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.793 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
aggctgtgccgcgcttgcgctcgccatcc	Protospacer
 *****.************ *****.. *

22. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 6, identity: 0.793 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cctcgacgccgcgctggagatcgccgcgc	Protospacer
*  * .********* * ***********

23. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 6, identity: 0.793 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
cttcatcgccgcccttgcgctcgccgcgc	Protospacer
*  *  ****** ****** *********

24. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.8 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
gctcccgcggcggcggttcggtgcgcaggg	Protospacer
 * ********* **********.**.* *

25. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
ctgcgcgcggcgtcgcgctcgacgggcgag	Protospacer
 .* ********* .************* *

26. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
acgagcgcggcgtgccgctcgacgacgccg	Protospacer
***.********** *********.   **

27. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 6, identity: 0.8 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
aggggggccgcgtgacgctcgacggcctgg	Protospacer
* *** ** **************** *  *

28. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
tctcgacgccgcgcgggcgatcgccgcgc	Protospacer
.  * .********  *************

29. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
tctcgacgccgcgcgggcgatcgccgcgc	Protospacer
.  * .********  *************

30. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gttcgccgccgcgcctgcgctcgccgcgc	Protospacer
   *  ********.**** *********

31. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
tctcgacgccgcgcgggcgatcgccgcgc	Protospacer
.  * .********  *************

32. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
ctatggcgccgcgcaggcgatcgccgcga	Protospacer
* .. *********  ************

33. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
ctatggcgccgcgcaggcgatcgccgcga	Protospacer
* .. *********  ************

34. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
ctatggcgccgcgcaggcgatcgccgcga	Protospacer
* .. *********  ************

35. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
tctcgacgccgcgcgggcgatcgccgcgc	Protospacer
.  * .********  *************

36. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
tctttccgccgcgcttgccatcaccgcgc	Protospacer
.  .* ************ ***.******

37. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gaacagcgcgacgcttgcgatcgccgcga	Protospacer
 ..* **** .*****************

38. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggtcgcgtcgccggttcggtgtgcgggc	Protospacer
.*. .**** ******************

39. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
cgggcagcggcgccggctcggtgtgcggca	Protospacer
. . * **********.************.

40. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggcagcggcgccggttcgctgtgccgct	Protospacer
.*. * ************** ***** **

41. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccgtcaccgccgccggttcggtgagcggcg	Protospacer
.*..*  ** ************* ******

42. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg----	CRISPR spacer
tctcccgcggcaccggttcggt----gacgccct	Protospacer
** ********.**********    *.**

43. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tagggcgcggcgcgacgctcgacgcggcct	Protospacer
  **********.*********** *  *

44. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
ggcggctcggcgggacgctcgacgggagtg	Protospacer
.  *** ***** ************* *.*

45. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgc-----ggcgtgacgctcgacgggcgcg	CRISPR spacer
-----cgccgccgggcgtgacgcgcgacgggcgcc	Protospacer
     ***     ********** **********

46. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
accggcgcgccgtgacgctcgacccgcatt	Protospacer
** ****** *************  **..

47. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgc-----ggcgtgacgctcgacgggcgcg	CRISPR spacer
-----cgccgccgggcgtgacgcgcgacgggcgcc	Protospacer
     ***     ********** **********

48. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
ataagaccggcgtgacgctcgtcgggctcg	Protospacer
*...*  ************** ***** **

49. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 7, identity: 0.767 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
ccgcttgcgacgcgacgctcgacgggcgcc	Protospacer
 **  .***.**.****************

50. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
atatggcgccgcgcaggcgatcgccgcga	Protospacer
  .. *********  ************

51. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gacgctcgccgcgcgggcgatcgccgcgc	Protospacer
 .  . ********  *************

52. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
ttatggcgccgcgcaggcgatcgccgcga	Protospacer
. .. *********  ************

53. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
atatggcgccgcgcaggcgatcgccgcga	Protospacer
  .. *********  ************

54. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
atatggcgccgcgcaggcgatcgccgcga	Protospacer
  .. *********  ************

55. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP006257 (Pseudomonas syringae pv. syringae HS191 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
tggctgggccgtgcttgcgatcgctcact	Protospacer
.***** ****.************.   .

56. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 8, identity: 0.724 

cggctgcgccgcgcttgcgatcgccgcgc	CRISPR spacer
gtcgcacgccgcgctcgcgatcgccgggc	Protospacer
    ..*********.********** **

57. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggccgcggcgcccgttcggtgagcgagc	Protospacer
.*. ********** ******** ***.

58. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccttccgcgtcgccggttcggtgtgttcgg	Protospacer
.* .***** ***************.   *

59. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tgtggggcggcgtgacgctcgacgtgctgc	Protospacer
   ** ****************** **

60. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

61. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tgtggggcggcgtgacgctcgacgtgctgc	Protospacer
   ** ****************** **

62. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

63. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cagggcgcggcgtgacggtcgacgacaaca	Protospacer
  *************** ******.  .*.

64. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN234205 (Mycobacterium phage Veliki, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

65. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MH727544 (Mycobacterium phage Dalmuri, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

66. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to JF704105 (Mycobacterium phage Adephagia, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

67. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN234198 (Mycobacterium phage Zavala, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

68. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MF140412 (Mycobacterium phage Jeckyll, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

69. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to KY380102 (Mycobacterium phage CREW, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

70. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to KX585253 (Mycobacterium phage HedwigODU, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

71. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN234230 (Mycobacterium phage Atiba, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

72. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MF140430 (Mycobacterium phage Tachez, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

73. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MF140428 (Mycobacterium phage Slimphazie, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

74. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MK460247 (Mycobacterium phage YoureAdopted, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

75. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN234231 (Mycobacterium phage Rapunzel97, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

76. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN908692 (Mycobacterium Phage BGlluviae, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

77. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_023747 (Mycobacterium phage BarrelRoll, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

78. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

79. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MH536821 (Mycobacterium phage Homura, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

80. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MF668267 (Mycobacterium phage Apocalypse, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

81. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MH697578 (Mycobacterium phage Belladonna, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

82. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MH509444 (Mycobacterium phage BEEST, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

83. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN369742 (Mycobacterium phage Spock, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

84. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MK112537 (Mycobacterium Phage Capricorn, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

85. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN369746 (Mycobacterium phage Inky, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

86. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MH051246 (Mycobacterium phage ActinUp, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

87. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN234197 (Mycobacterium phage Ramen, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
cgctgcgcggcgagacgctcggcgggcgtc	Protospacer
    ******** ********.******.

88. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP015523 (Sphingomonas sp. NIC1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
ccgggcgcgacgtgccgctcgacgtattcc	Protospacer
 ********.**** ********* .. *

89. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

90. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP049735 (Rhizobium leguminosarum strain A1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
acgggcgcgccgtcacgctcgaccagtctc	Protospacer
********* *** ********* .*. .

91. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

92. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
acgggcgcgccgtcacgctcgaccagtctc	Protospacer
********* *** ********* .*. .

93. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

94. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

95. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tcgaaacacgcgtgacgctcgccgggcgcg	Protospacer
 **..    ************ ********

96. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to CP049735 (Rhizobium leguminosarum strain A1 plasmid pRLa12, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
acgggcgcgccgtcacgctcgaccagtctc	Protospacer
********* *** ********* .*. .

97. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tgcagcgcggcgtgccgatcgacgggctgg	Protospacer
   .********** ** *********  *

98. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

99. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

100. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
agcttgtcggcgtgacgctcgacgctcgcg	Protospacer
*      *****************  ****

101. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

102. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

103. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

104. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gcatcggcggcatggcgctcgacgggcgca	Protospacer
.*.   *****.**.**************.

105. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tcgggcacggcgtgacgcgcgacgacgtcc	Protospacer
 *****.*********** *****.   *

106. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to HQ332141 (Halorubrum phage CGphi46 genomic sequence) position: , mismatch: 8, identity: 0.733 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
tcgggcgcgtcgtgacgctcgccgtcggac	Protospacer
 ******** *********** **   *

107. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
cgggtcaatgcgccggttcggtgtccggcg	Protospacer
. . .*.  *************** *****

108. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccacccgcggcggcagttcggtgtaataat	Protospacer
.*********** *.*********.  .

109. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
agcagagcggccccggttcggggtgcggcc	Protospacer
      ***** ********* *******

110. spacer 4.1|1281956|30|NZ_CP010114|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
agcagagcggccccggttcggggtgcggcc	Protospacer
      ***** ********* *******

111. spacer 5.1|2033888|30|NZ_CP010114|CRISPRCasFinder matches to NZ_LR134466 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence) position: , mismatch: 9, identity: 0.7 

acgggcgcggcgtgacgctcgacgggcgcg	CRISPR spacer
gtccgcgcggtgtgccgctcgacgggcatc	Protospacer
..  ******.*** ************..

112. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.655 

cggctgcgccgcgcttgcgatcgccgcgc-----	CRISPR spacer
-----gcgccgcgatcgcaagcgctgcgccggcc	Protospacer
     ******** *.**.* ***.****

113. spacer 2.1|1078280|29|NZ_CP010114|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.655 

cggctgcgccgcgcttgcgatcgccgcgc-----	CRISPR spacer
-----gcgccgcgatcgcaagcgctgcgccggcc	Protospacer
     ******** *.**.* ***.****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 750000 : 756572 7 Bacillus_phage(33.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage