Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007471 Haemophilus influenzae strain C486, complete genome 2 crisprs DinG,DEDDh,cas3,WYL 0 1 5 0

Results visualization

1. NZ_CP007471
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007471_1 713677-713756 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007471_2 1120352-1120439 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007471_1 1.1|713700|34|NZ_CP007471|CRISPRCasFinder 713700-713733 34 MH572422 Microviridae sp. isolate SD_MC_8, complete genome 4166-4199 9 0.735

1. spacer 1.1|713700|34|NZ_CP007471|CRISPRCasFinder matches to MH572422 (Microviridae sp. isolate SD_MC_8, complete genome) position: , mismatch: 9, identity: 0.735

catcgccattaagtaccacgaaatctttcgcctt	CRISPR spacer
ttttaccattaagtaccacaaaatcattcggata	Protospacer
. *..**************.***** ****  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1237266 : 1243944 9 Sodalis_phage(16.67%) NA NA
DBSCAN-SWA_2 1315054 : 1327027 11 Acinetobacter_phage(42.86%) tRNA NA
DBSCAN-SWA_3 1604082 : 1612600 9 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_4 1640625 : 1717963 87 Haemophilus_phage(48.89%) integrase,plate,head,protease,tail,terminase,transposase attL 1684285:1684306|attR 1729037:1729058
DBSCAN-SWA_5 1780268 : 1789336 9 Escherichia_phage(83.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage