Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010977 Paenibacillus sp. IHBB 10380 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010976 Paenibacillus sp. IHBB 10380 chromosome, complete genome 10 crisprs cas7,cas5,cas3,cas4,cas1,cas2,WYL,csa3,DEDDh,DinG,RT 21 23 5 0

Results visualization

1. NZ_CP010976
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_1 242420-243553 Unclear NA:I-A
17 spacers
cas6,cas7,cas5,cas3,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_2 256182-257512 Unclear I-A
20 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_3 633558-633640 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_4 710254-710417 Orphan I-C
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_5 2735725-2739434 Orphan NA
55 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_6 3654760-3654911 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_7 3841630-3842055 Orphan I-C
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_8 4238652-4238948 Orphan NA:I-C
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_9 5530821-5530906 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010976_10 5705762-5705866 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742873-2742897 0 1.0
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742981-2743005 0 1.0
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2743053-2743077 0 1.0
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2743827-2743851 0 1.0
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742873-2742897 0 1.0
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742981-2743005 0 1.0
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2743053-2743077 0 1.0
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2743827-2743851 0 1.0
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2744313-2744337 0 1.0
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2744403-2744427 0 1.0
NZ_CP010976_5 5.51|2739111|43|NZ_CP010976|CRT 2739111-2739153 43 NZ_CP010976.1 2742225-2742267 0 1.0
NZ_CP010976_5 5.51|2739111|43|NZ_CP010976|CRT 2739111-2739153 43 NZ_CP010976.1 2742423-2742465 0 1.0
NZ_CP010976_5 5.51|2739111|43|NZ_CP010976|CRT 2739111-2739153 43 NZ_CP010976.1 2742729-2742771 0 1.0
NZ_CP010976_7 7.3|3841792|34|NZ_CP010976|CRT,CRISPRCasFinder 3841792-3841825 34 NZ_CP010976.1 2975900-2975933 0 1.0
NZ_CP010976_7 7.8|3841793|34|NZ_CP010976|PILER-CR 3841793-3841826 34 NZ_CP010976.1 2975900-2975933 0 1.0
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742072-2742096 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742090-2742114 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742108-2742132 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742126-2742150 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742576-2742600 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742594-2742618 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742612-2742636 1 0.96
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742630-2742654 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742072-2742096 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742090-2742114 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742108-2742132 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742126-2742150 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742576-2742600 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742594-2742618 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742612-2742636 1 0.96
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2742630-2742654 1 0.96
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742225-2742249 1 0.96
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742423-2742447 1 0.96
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742558-2742582 1 0.96
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742729-2742753 1 0.96
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2741613-2741637 1 0.96
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742558-2742582 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2741667-2741691 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742315-2742339 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742819-2742843 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2743215-2743239 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2743251-2743275 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2743269-2743293 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2743863-2743887 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2744061-2744085 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2744187-2744211 1 0.96
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2744259-2744283 1 0.96
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP010976.1 2741577-2741601 1 0.96
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP010976.1 2742540-2742564 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2741667-2741691 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742315-2742339 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742819-2742843 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2743215-2743239 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2743251-2743275 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2743269-2743293 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2743863-2743887 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2744061-2744085 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2744187-2744211 1 0.96
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2744259-2744283 1 0.96
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP010976.1 2741577-2741601 1 0.96
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP010976.1 2742540-2742564 1 0.96
NZ_CP010976_5 5.37|2738238|25|NZ_CP010976|CRT 2738238-2738262 25 NZ_CP010976.1 2744133-2744157 1 0.96
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2741865-2741889 1 0.96
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2742243-2742267 1 0.96
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2742441-2742465 1 0.96
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2742747-2742771 1 0.96
NZ_CP010976_5 5.40|2738400|25|NZ_CP010976|CRT 2738400-2738424 25 NZ_CP010976.1 2741865-2741889 1 0.96
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2741775-2741799 1 0.96
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2741973-2741997 1 0.96
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2742189-2742213 1 0.96
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2742387-2742411 1 0.96
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2742693-2742717 1 0.96
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2741865-2741889 1 0.96
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2742243-2742267 1 0.96
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2742441-2742465 1 0.96
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2742747-2742771 1 0.96
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP010976.1 2742279-2742303 1 0.96
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP010976.1 2742477-2742501 1 0.96
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP010976.1 2742783-2742807 1 0.96
NZ_CP010976_5 5.9|2736375|25|NZ_CP010976|CRT 2736375-2736399 25 NZ_CP010976.1 2739417-2739441 2 0.92
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP010976.1 2743386-2743419 2 0.941
NZ_CP010976_5 5.13|2736654|25|NZ_CP010976|CRT 2736654-2736678 25 NZ_CP010976.1 2741613-2741637 2 0.92
NZ_CP010976_5 5.13|2736654|25|NZ_CP010976|CRT 2736654-2736678 25 NZ_CP010976.1 2741631-2741655 2 0.92
NZ_CP010976_5 5.13|2736654|25|NZ_CP010976|CRT 2736654-2736678 25 NZ_CP010976.1 2741847-2741871 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2741595-2741619 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2741757-2741781 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742315-2742339 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2742819-2742843 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2743251-2743275 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2743269-2743293 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2743287-2743311 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2743863-2743887 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2744259-2744283 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2744295-2744319 2 0.92
NZ_CP010976_5 5.23|2737401|25|NZ_CP010976|CRT 2737401-2737425 25 NZ_CP010976.1 2744385-2744409 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2741595-2741619 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2741757-2741781 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2743251-2743275 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2743269-2743293 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2743287-2743311 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2743647-2743671 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2743863-2743887 2 0.92
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NZ_CP010976.1 2744259-2744283 2 0.92
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742333-2742357 2 0.92
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742495-2742519 2 0.92
NZ_CP010976_5 5.30|2737860|25|NZ_CP010976|CRT 2737860-2737884 25 NZ_CP010976.1 2742837-2742861 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2741631-2741655 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2741847-2741871 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742225-2742249 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742333-2742357 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742423-2742447 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742495-2742519 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742729-2742753 2 0.92
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NZ_CP010976.1 2742837-2742861 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742072-2742096 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742090-2742114 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742108-2742132 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742126-2742150 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742576-2742600 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742594-2742618 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742612-2742636 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2742630-2742654 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2744277-2744301 2 0.92
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP010976.1 2744367-2744391 2 0.92
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP010976.1 2742054-2742078 2 0.92
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP010976.1 2743179-2743203 2 0.92
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP010976.1 2743629-2743653 2 0.92
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP010976.1 2743791-2743815 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742072-2742096 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742090-2742114 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742108-2742132 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742126-2742150 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742576-2742600 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742594-2742618 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742612-2742636 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2742630-2742654 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2744277-2744301 2 0.92
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP010976.1 2744367-2744391 2 0.92
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP010976.1 2742054-2742078 2 0.92
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP010976.1 2743179-2743203 2 0.92
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP010976.1 2743629-2743653 2 0.92
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP010976.1 2743791-2743815 2 0.92
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP010976.1 2741775-2741799 2 0.92
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP010976.1 2742279-2742303 2 0.92
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP010976.1 2742477-2742501 2 0.92
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP010976.1 2742783-2742807 2 0.92
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP010976.1 2742927-2742951 2 0.92
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP010976.1 2743305-2743329 2 0.92
NZ_CP010976_5 5.37|2738238|25|NZ_CP010976|CRT 2738238-2738262 25 NZ_CP010976.1 2741775-2741799 2 0.92
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2741649-2741673 2 0.92
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2741685-2741709 2 0.92
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2743467-2743491 2 0.92
NZ_CP010976_5 5.39|2738346|25|NZ_CP010976|CRT 2738346-2738370 25 NZ_CP010976.1 2743593-2743617 2 0.92
NZ_CP010976_5 5.40|2738400|25|NZ_CP010976|CRT 2738400-2738424 25 NZ_CP010976.1 2741649-2741673 2 0.92
NZ_CP010976_5 5.40|2738400|25|NZ_CP010976|CRT 2738400-2738424 25 NZ_CP010976.1 2741685-2741709 2 0.92
NZ_CP010976_5 5.40|2738400|25|NZ_CP010976|CRT 2738400-2738424 25 NZ_CP010976.1 2743467-2743491 2 0.92
NZ_CP010976_5 5.40|2738400|25|NZ_CP010976|CRT 2738400-2738424 25 NZ_CP010976.1 2743593-2743617 2 0.92
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2742297-2742321 2 0.92
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2742801-2742825 2 0.92
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2742927-2742951 2 0.92
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 NZ_CP010976.1 2743305-2743329 2 0.92
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2741649-2741673 2 0.92
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2741685-2741709 2 0.92
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2743467-2743491 2 0.92
NZ_CP010976_5 5.45|2738751|25|NZ_CP010976|CRT 2738751-2738775 25 NZ_CP010976.1 2743593-2743617 2 0.92
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP010976.1 2742297-2742321 2 0.92
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP010976.1 2742801-2742825 2 0.92

1. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742873-2742897, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

2. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742981-2743005, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

3. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2743053-2743077, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

4. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2743827-2743851, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

5. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742873-2742897, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

6. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742981-2743005, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

7. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2743053-2743077, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

8. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2743827-2743851, mismatch: 0, identity: 1.0 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtaacc	Protospacer
*************************

9. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2744313-2744337, mismatch: 0, identity: 1.0 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaaccccagtcgctcccgttact	Protospacer
*************************

10. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2744403-2744427, mismatch: 0, identity: 1.0 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaaccccagtcgctcccgttact	Protospacer
*************************

11. spacer 5.51|2739111|43|NZ_CP010976|CRT matches to position: 2742225-2742267, mismatch: 0, identity: 1.0 

ggtaaccccagtcgcacctgtaaccccagttgctcccgtaact	CRISPR spacer
ggtaaccccagtcgcacctgtaaccccagttgctcccgtaact	Protospacer
*******************************************

12. spacer 5.51|2739111|43|NZ_CP010976|CRT matches to position: 2742423-2742465, mismatch: 0, identity: 1.0 

ggtaaccccagtcgcacctgtaaccccagttgctcccgtaact	CRISPR spacer
ggtaaccccagtcgcacctgtaaccccagttgctcccgtaact	Protospacer
*******************************************

13. spacer 5.51|2739111|43|NZ_CP010976|CRT matches to position: 2742729-2742771, mismatch: 0, identity: 1.0 

ggtaaccccagtcgcacctgtaaccccagttgctcccgtaact	CRISPR spacer
ggtaaccccagtcgcacctgtaaccccagttgctcccgtaact	Protospacer
*******************************************

14. spacer 7.3|3841792|34|NZ_CP010976|CRT,CRISPRCasFinder matches to position: 2975900-2975933, mismatch: 0, identity: 1.0 

aagaaatgcgtcagatttttaagatactacaaga	CRISPR spacer
aagaaatgcgtcagatttttaagatactacaaga	Protospacer
**********************************

15. spacer 7.8|3841793|34|NZ_CP010976|PILER-CR matches to position: 2975900-2975933, mismatch: 0, identity: 1.0 

aagaaatgcgtcagatttttaagatactacaaga	CRISPR spacer
aagaaatgcgtcagatttttaagatactacaaga	Protospacer
**********************************

16. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742072-2742096, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

17. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742090-2742114, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

18. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742108-2742132, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

19. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742126-2742150, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

20. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742576-2742600, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

21. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742594-2742618, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

22. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742612-2742636, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

23. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742630-2742654, mismatch: 1, identity: 0.96 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

24. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742072-2742096, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

25. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742090-2742114, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

26. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742108-2742132, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

27. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742126-2742150, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

28. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742576-2742600, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

29. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742594-2742618, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

30. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742612-2742636, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

31. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2742630-2742654, mismatch: 1, identity: 0.96 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
*************.***********

32. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742225-2742249, mismatch: 1, identity: 0.96 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaaccccagtcgcacctgtaacc	Protospacer
******************.******

33. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742423-2742447, mismatch: 1, identity: 0.96 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaaccccagtcgcacctgtaacc	Protospacer
******************.******

34. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742558-2742582, mismatch: 1, identity: 0.96 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaaccccagtcgctcccgtaacc	Protospacer
*************** *********

35. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742729-2742753, mismatch: 1, identity: 0.96 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaaccccagtcgcacctgtaacc	Protospacer
******************.******

36. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2741613-2741637, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagttgctccggtaacc	Protospacer
************.************

37. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742558-2742582, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagtcgctcccgtaacc	Protospacer
****************** ******

38. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2741667-2741691, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcctgtaacc	Protospacer
******************.******

39. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742315-2742339, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctccggtaacc	Protospacer
****************** ******

40. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742819-2742843, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctccggtaacc	Protospacer
****************** ******

41. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2743215-2743239, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtttctcccgtaacc	Protospacer
************* ***********

42. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2743251-2743275, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
************.************

43. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2743269-2743293, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagttgctcccgtaacc	Protospacer
******.******************

44. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2743863-2743887, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
************.************

45. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2744061-2744085, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtatcc	Protospacer
********************** **

46. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2744187-2744211, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtatcc	Protospacer
********************** **

47. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2744259-2744283, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
************.************

48. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to position: 2741577-2741601, mismatch: 1, identity: 0.96 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccgtaacc	Protospacer
****************** ******

49. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to position: 2742540-2742564, mismatch: 1, identity: 0.96 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaactccagttgctccggtaacc	Protospacer
******.******************

50. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2741667-2741691, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcctgtaacc	Protospacer
******************.******

51. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742315-2742339, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctccggtaacc	Protospacer
****************** ******

52. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742819-2742843, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctccggtaacc	Protospacer
****************** ******

53. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2743215-2743239, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtttctcccgtaacc	Protospacer
************* ***********

54. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2743251-2743275, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
************.************

55. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2743269-2743293, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagttgctcccgtaacc	Protospacer
******.******************

56. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2743863-2743887, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
************.************

57. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2744061-2744085, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtatcc	Protospacer
********************** **

58. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2744187-2744211, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagttgctcccgtatcc	Protospacer
********************** **

59. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2744259-2744283, mismatch: 1, identity: 0.96 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
************.************

60. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to position: 2741577-2741601, mismatch: 1, identity: 0.96 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccgtaacc	Protospacer
****************** ******

61. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to position: 2742540-2742564, mismatch: 1, identity: 0.96 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaactccagttgctccggtaacc	Protospacer
******.******************

62. spacer 5.37|2738238|25|NZ_CP010976|CRT matches to position: 2744133-2744157, mismatch: 1, identity: 0.96 

ggtaatcccagttgctcccgtaact	CRISPR spacer
ggtaatccctgttgctcccgtaact	Protospacer
********* ***************

63. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2741865-2741889, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgttact	Protospacer
************.************

64. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2742243-2742267, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagttgctcccgtaact	Protospacer
********************* ***

65. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2742441-2742465, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagttgctcccgtaact	Protospacer
********************* ***

66. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2742747-2742771, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagttgctcccgtaact	Protospacer
********************* ***

67. spacer 5.40|2738400|25|NZ_CP010976|CRT matches to position: 2741865-2741889, mismatch: 1, identity: 0.96 

tgtaactccagtcgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgttact	Protospacer
******.******************

68. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2741775-2741799, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaaccccagttgctcccgttact	Protospacer
************.************

69. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2741973-2741997, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaacaccagtcgctcccgttact	Protospacer
****** ******************

70. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2742189-2742213, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaactccagtcgctcccgttact	Protospacer
******.******************

71. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2742387-2742411, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaactccagtcgctcccgttact	Protospacer
******.******************

72. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2742693-2742717, mismatch: 1, identity: 0.96 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaactccagtcgctcccgttact	Protospacer
******.******************

73. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2741865-2741889, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgttact	Protospacer
************.************

74. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2742243-2742267, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagttgctcccgtaact	Protospacer
********************* ***

75. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2742441-2742465, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagttgctcccgtaact	Protospacer
********************* ***

76. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2742747-2742771, mismatch: 1, identity: 0.96 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagttgctcccgtaact	Protospacer
********************* ***

77. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to position: 2742279-2742303, mismatch: 1, identity: 0.96 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctccggtaact	Protospacer
************.************

78. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to position: 2742477-2742501, mismatch: 1, identity: 0.96 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctccggtaact	Protospacer
************.************

79. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to position: 2742783-2742807, mismatch: 1, identity: 0.96 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctccggtaact	Protospacer
************.************

80. spacer 5.9|2736375|25|NZ_CP010976|CRT matches to position: 2739417-2739441, mismatch: 2, identity: 0.92 

ggtaactccagtttcacctgtaacc	CRISPR spacer
ggtaactccagttgcacctttaacc	Protospacer
************* ***** *****

81. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to position: 2743386-2743419, mismatch: 2, identity: 0.941 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
agttgctcccgtaactccagttgctcccgtaaca	Protospacer
************ **************.******

82. spacer 5.13|2736654|25|NZ_CP010976|CRT matches to position: 2741613-2741637, mismatch: 2, identity: 0.92 

ggtaaccccagttgccccagtaacc	CRISPR spacer
ggtaaccccagttgctccggtaacc	Protospacer
***************.**.******

83. spacer 5.13|2736654|25|NZ_CP010976|CRT matches to position: 2741631-2741655, mismatch: 2, identity: 0.92 

ggtaaccccagttgccccagtaacc	CRISPR spacer
ggtaaccccagttgctcctgtaacc	Protospacer
***************.** ******

84. spacer 5.13|2736654|25|NZ_CP010976|CRT matches to position: 2741847-2741871, mismatch: 2, identity: 0.92 

ggtaaccccagttgccccagtaacc	CRISPR spacer
ggtaaccccagttgctcctgtaacc	Protospacer
***************.** ******

85. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2741595-2741619, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagttactccggtaacc	Protospacer
************..***********

86. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2741757-2741781, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagttactccggtaacc	Protospacer
************..***********

87. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742315-2742339, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaactccagttgctccggtaacc	Protospacer
******.*****.************

88. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2742819-2742843, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaactccagttgctccggtaacc	Protospacer
******.*****.************

89. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2743251-2743275, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
******.*********** ******

90. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2743269-2743293, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagttgctcccgtaacc	Protospacer
************.***** ******

91. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2743287-2743311, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagttactccggtaacc	Protospacer
************..***********

92. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2743863-2743887, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
******.*********** ******

93. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2744259-2744283, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
******.*********** ******

94. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2744295-2744319, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtttctccggtaacc	Protospacer
************. ***********

95. spacer 5.23|2737401|25|NZ_CP010976|CRT matches to position: 2744385-2744409, mismatch: 2, identity: 0.92 

cgtaaccccagtcgctccggtaacc	CRISPR spacer
cgtaaccccagtttctccggtaacc	Protospacer
************. ***********

96. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2741595-2741619, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagttactccggtaacc	Protospacer
************.***** ******

97. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2741757-2741781, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagttactccggtaacc	Protospacer
************.***** ******

98. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2743251-2743275, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
******.******.***********

99. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2743269-2743293, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagttgctcccgtaacc	Protospacer
************..***********

100. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2743287-2743311, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaaccccagttactccggtaacc	Protospacer
************.***** ******

101. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2743647-2743671, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtatccccagtcacacccgtaacc	Protospacer
**** ********** *********

102. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2743863-2743887, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
******.******.***********

103. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to position: 2744259-2744283, mismatch: 2, identity: 0.92 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
cgtaactccagtcgctcccgtaacc	Protospacer
******.******.***********

104. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742333-2742357, mismatch: 2, identity: 0.92 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaaccccagtcactcccgtaacc	Protospacer
*************.* *********

105. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742495-2742519, mismatch: 2, identity: 0.92 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaactccagtcgctcccgtaacc	Protospacer
******.******** *********

106. spacer 5.30|2737860|25|NZ_CP010976|CRT matches to position: 2742837-2742861, mismatch: 2, identity: 0.92 

ggtaaccccagtcgcacccgtaacc	CRISPR spacer
ggtaaccccagtcactcccgtaacc	Protospacer
*************.* *********

107. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2741631-2741655, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagttgctcctgtaacc	Protospacer
************.***** ******

108. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2741847-2741871, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagttgctcctgtaacc	Protospacer
************.***** ******

109. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742225-2742249, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagtcgcacctgtaacc	Protospacer
*************** ** ******

110. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742333-2742357, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagtcactcccgtaacc	Protospacer
*************.**** ******

111. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742423-2742447, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagtcgcacctgtaacc	Protospacer
*************** ** ******

112. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742495-2742519, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaactccagtcgctcccgtaacc	Protospacer
******.*********** ******

113. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742729-2742753, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagtcgcacctgtaacc	Protospacer
*************** ** ******

114. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to position: 2742837-2742861, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaaccccagtcactcccgtaacc	Protospacer
*************.**** ******

115. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742072-2742096, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

116. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742090-2742114, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

117. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742108-2742132, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

118. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742126-2742150, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

119. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742576-2742600, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

120. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742594-2742618, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

121. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742612-2742636, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

122. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2742630-2742654, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

123. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2744277-2744301, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagttgcacccgtaacc	Protospacer
******.******** *********

124. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to position: 2744367-2744391, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagttgcacccgtaacc	Protospacer
******.******** *********

125. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to position: 2742054-2742078, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagtcgctcccgtaacc	Protospacer
************.***** ******

126. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to position: 2743179-2743203, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccataacc	Protospacer
****************** .*****

127. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to position: 2743629-2743653, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccgtatcc	Protospacer
****************** *** **

128. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to position: 2743791-2743815, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccataacc	Protospacer
****************** .*****

129. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742072-2742096, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

130. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742090-2742114, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

131. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742108-2742132, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

132. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742126-2742150, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

133. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742576-2742600, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

134. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742594-2742618, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

135. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742612-2742636, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

136. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2742630-2742654, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagtcgctcccgtaacc	Protospacer
******.*****.************

137. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2744277-2744301, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagttgcacccgtaacc	Protospacer
******.******** *********

138. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to position: 2744367-2744391, mismatch: 2, identity: 0.92 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaaccccagttgcacccgtaacc	Protospacer
******.******** *********

139. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to position: 2742054-2742078, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagtcgctcccgtaacc	Protospacer
************.***** ******

140. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to position: 2743179-2743203, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccataacc	Protospacer
****************** .*****

141. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to position: 2743629-2743653, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccgtatcc	Protospacer
****************** *** **

142. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to position: 2743791-2743815, mismatch: 2, identity: 0.92 

tgtaaccccagttgctccggtaacc	CRISPR spacer
tgtaaccccagttgctcccataacc	Protospacer
****************** .*****

143. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to position: 2741775-2741799, mismatch: 2, identity: 0.92 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaaccccagttgctcccgttact	Protospacer
****************** ** ***

144. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to position: 2742279-2742303, mismatch: 2, identity: 0.92 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctccggtaact	Protospacer
******.*****.************

145. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to position: 2742477-2742501, mismatch: 2, identity: 0.92 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctccggtaact	Protospacer
******.*****.************

146. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to position: 2742783-2742807, mismatch: 2, identity: 0.92 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctccggtaact	Protospacer
******.*****.************

147. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to position: 2742927-2742951, mismatch: 2, identity: 0.92 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaaccccagttgctcctgttact	Protospacer
****************** ** ***

148. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to position: 2743305-2743329, mismatch: 2, identity: 0.92 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaaccccagttgctcctgttact	Protospacer
****************** ** ***

149. spacer 5.37|2738238|25|NZ_CP010976|CRT matches to position: 2741775-2741799, mismatch: 2, identity: 0.92 

ggtaatcccagttgctcccgtaact	CRISPR spacer
ggtaaccccagttgctcccgttact	Protospacer
*****.*************** ***

150. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2741649-2741673, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
************.******** ***

151. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2741685-2741709, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccattact	Protospacer
************.******.*****

152. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2743467-2743491, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
************.******** ***

153. spacer 5.39|2738346|25|NZ_CP010976|CRT matches to position: 2743593-2743617, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
************.******** ***

154. spacer 5.40|2738400|25|NZ_CP010976|CRT matches to position: 2741649-2741673, mismatch: 2, identity: 0.92 

tgtaactccagtcgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
******.************** ***

155. spacer 5.40|2738400|25|NZ_CP010976|CRT matches to position: 2741685-2741709, mismatch: 2, identity: 0.92 

tgtaactccagtcgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccattact	Protospacer
******.************.*****

156. spacer 5.40|2738400|25|NZ_CP010976|CRT matches to position: 2743467-2743491, mismatch: 2, identity: 0.92 

tgtaactccagtcgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
******.************** ***

157. spacer 5.40|2738400|25|NZ_CP010976|CRT matches to position: 2743593-2743617, mismatch: 2, identity: 0.92 

tgtaactccagtcgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
******.************** ***

158. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2742297-2742321, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaactccagtcgctcccgtaact	Protospacer
******.************** ***

159. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2742801-2742825, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaactccagtcgctcccgtaact	Protospacer
******.************** ***

160. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2742927-2742951, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaaccccagttgctcctgttact	Protospacer
************.*****.******

161. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to position: 2743305-2743329, mismatch: 2, identity: 0.92 

ggtaaccccagtcgctcccgttact	CRISPR spacer
ggtaaccccagttgctcctgttact	Protospacer
************.*****.******

162. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2741649-2741673, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
************.******** ***

163. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2741685-2741709, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccattact	Protospacer
************.******.*****

164. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2743467-2743491, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
************.******** ***

165. spacer 5.45|2738751|25|NZ_CP010976|CRT matches to position: 2743593-2743617, mismatch: 2, identity: 0.92 

tgtaaccccagttgctcccgttact	CRISPR spacer
tgtaaccccagtcgctcccgtaact	Protospacer
************.******** ***

166. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to position: 2742297-2742321, mismatch: 2, identity: 0.92 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctcccgtaact	Protospacer
************.***** ******

167. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to position: 2742801-2742825, mismatch: 2, identity: 0.92 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaactccagtcgctcccgtaact	Protospacer
************.***** ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010976_1 1.21|242644|36|NZ_CP010976|CRISPRCasFinder,CRT 242644-242679 36 NZ_CP018621 Paenibacillus xylanexedens strain PAMC 22703 plasmid unnamed, complete sequence 41516-41551 1 0.972
NZ_CP010976_1 1.4|242642|38|NZ_CP010976|PILER-CR 242642-242679 38 NZ_CP018621 Paenibacillus xylanexedens strain PAMC 22703 plasmid unnamed, complete sequence 41514-41551 2 0.947
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368393-368417 3 0.88
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368411-368435 3 0.88
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 5987-6011 3 0.88
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 12241-12265 3 0.88
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368393-368417 3 0.88
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368411-368435 3 0.88
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 5987-6011 3 0.88
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 12241-12265 3 0.88
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324531-324555 3 0.88
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324891-324915 3 0.88
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP049245 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence 84986-85010 3 0.88
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51794-51818 3 0.88
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51956-51980 3 0.88
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52649-52673 3 0.88
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324531-324555 3 0.88
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324891-324915 3 0.88
NZ_CP010976_5 5.9|2736375|25|NZ_CP010976|CRT 2736375-2736399 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51794-51818 4 0.84
NZ_CP010976_5 5.9|2736375|25|NZ_CP010976|CRT 2736375-2736399 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51956-51980 4 0.84
NZ_CP010976_5 5.13|2736654|25|NZ_CP010976|CRT 2736654-2736678 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324963-324987 4 0.84
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 312715-312739 4 0.84
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52118-52142 4 0.84
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52235-52259 4 0.84
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53045-53069 4 0.84
NZ_CP010976_5 5.27|2737689|25|NZ_CP010976|CRT 2737689-2737713 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 53162-53186 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 312715-312739 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368393-368417 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368411-368435 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51794-51818 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51956-51980 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 20-44 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 74-98 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 183-207 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 273-297 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 381-405 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 5987-6011 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6005-6029 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6275-6299 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6329-6353 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6437-6461 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6527-6551 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6635-6659 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 12241-12265 4 0.84
NZ_CP010976_5 5.29|2737806|25|NZ_CP010976|CRT 2737806-2737830 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 12259-12283 4 0.84
NZ_CP010976_5 5.31|2737914|25|NZ_CP010976|CRT 2737914-2737938 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 52649-52673 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368429-368453 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 20-44 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 74-98 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 183-207 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 273-297 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 381-405 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6005-6029 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6275-6299 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6329-6353 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6437-6461 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6527-6551 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6635-6659 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 12259-12283 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51794-51818 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51956-51980 4 0.84
NZ_CP010976_5 5.32|2737968|25|NZ_CP010976|CRT 2737968-2737992 25 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 312715-312739 4 0.84
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324531-324555 4 0.84
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324783-324807 4 0.84
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324891-324915 4 0.84
NZ_CP010976_5 5.33|2738022|25|NZ_CP010976|CRT 2738022-2738046 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324909-324933 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 368429-368453 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 20-44 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 74-98 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 183-207 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 273-297 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 381-405 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6005-6029 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6275-6299 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6329-6353 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6437-6461 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6527-6551 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 6635-6659 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NZ_CP015256 Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence 12259-12283 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51794-51818 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NC_014025 Bacillus megaterium QM B1551 plasmid pBM500, complete sequence 51956-51980 4 0.84
NZ_CP010976_5 5.34|2738076|25|NZ_CP010976|CRT 2738076-2738100 25 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 312715-312739 4 0.84
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324531-324555 4 0.84
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324783-324807 4 0.84
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324891-324915 4 0.84
NZ_CP010976_5 5.35|2738130|25|NZ_CP010976|CRT 2738130-2738154 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324909-324933 4 0.84
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324783-324807 4 0.84
NZ_CP010976_5 5.36|2738184|25|NZ_CP010976|CRT 2738184-2738208 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324909-324933 4 0.84
NZ_CP010976_5 5.43|2738616|25|NZ_CP010976|CRT 2738616-2738640 25 MN693809 Marine virus AFVG_250M1103, complete genome 28425-28449 4 0.84
NZ_CP010976_5 5.47|2738877|25|NZ_CP010976|CRT 2738877-2738901 25 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 24049-24073 4 0.84
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324783-324807 4 0.84
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 324909-324933 4 0.84
NZ_CP010976_5 5.55|2739381|25|NZ_CP010976|CRT 2739381-2739405 25 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 512521-512545 4 0.84
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321842-321875 5 0.853
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321914-321947 5 0.853
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 100-133 5 0.853
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 172-205 5 0.853
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 199-232 5 0.853
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 271-304 5 0.853
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 298-331 5 0.853
NZ_CP010976_5 5.53|2739255|25|NZ_CP010976|CRT 2739255-2739279 25 MT024867 Arthrobacter phage BlueFeather, complete genome 12095-12119 5 0.8
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321806-321839 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321869-321902 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321887-321920 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 127-160 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 145-178 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 226-259 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 244-277 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 334-367 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130734-130767 6 0.824
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 130770-130803 6 0.824
NZ_CP010976_7 7.1|3841662|33|NZ_CP010976|CRT 3841662-3841694 33 NZ_CP016798 Lactobacillus brevis strain TMW 1.2112 plasmid pl12112-1, complete sequence 38553-38585 6 0.818
NZ_CP010976_10 10.1|5705801|27|NZ_CP010976|CRISPRCasFinder 5705801-5705827 27 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1124593-1124619 6 0.778
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321698-321731 7 0.794
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321743-321776 7 0.794
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 397-430 7 0.794
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 442-475 7 0.794
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 68905-68938 7 0.794
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 72732-72765 7 0.794
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73963-73996 7 0.794
NZ_CP010976_7 7.1|3841662|33|NZ_CP010976|CRT 3841662-3841694 33 MH884514 Bacillus phage vB_BpsM-61, complete genome 9193-9225 8 0.758
NZ_CP010976_2 2.20|257448|36|NZ_CP010976|PILER-CR,CRISPRCasFinder,CRT 257448-257483 36 NC_016562 Campylobacter phage CPX, complete genome 5960-5995 9 0.75
NZ_CP010976_5 5.11|2736501|34|NZ_CP010976|CRT 2736501-2736534 34 NZ_CP019235 Bacillus thuringiensis strain YGd22-03 plasmid pYGD98, complete sequence 79853-79886 9 0.735
NZ_CP010976_7 7.1|3841662|33|NZ_CP010976|CRT 3841662-3841694 33 HQ634191 Cyanophage Syn10 genomic sequence 146666-146698 9 0.727
NZ_CP010976_7 7.1|3841662|33|NZ_CP010976|CRT 3841662-3841694 33 DQ149023 Synechococcus cyanophage syn9, complete genome 2912-2944 9 0.727
NZ_CP010976_7 7.1|3841662|33|NZ_CP010976|CRT 3841662-3841694 33 NC_008296 Synechococcus phage syn9, complete genome 2912-2944 9 0.727
NZ_CP010976_2 2.9|256734|37|NZ_CP010976|PILER-CR,CRISPRCasFinder,CRT 256734-256770 37 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 170354-170390 10 0.73
NZ_CP010976_4 4.2|710351|35|NZ_CP010976|CRISPRCasFinder 710351-710385 35 NC_015162 Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence 36206-36240 10 0.714
NZ_CP010976_5 5.28|2737743|34|NZ_CP010976|CRT 2737743-2737776 34 NZ_CP017721 Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 plasmid pCFSAN017963_01, complete sequence 28516-28549 10 0.706
NZ_CP010976_7 7.1|3841662|33|NZ_CP010976|CRT 3841662-3841694 33 NZ_CP045273 Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence 620075-620107 10 0.697
NZ_CP010976_4 4.2|710351|35|NZ_CP010976|CRISPRCasFinder 710351-710385 35 MK295203 Escherichia phage vB_EcoM_005, complete genome 23650-23684 11 0.686

1. spacer 1.21|242644|36|NZ_CP010976|CRISPRCasFinder,CRT matches to NZ_CP018621 (Paenibacillus xylanexedens strain PAMC 22703 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.972 

ttattaagctgcgcaatttagttagagcttttaagc	CRISPR spacer
ttattaagttgcgcaatttagttagagcttttaagc	Protospacer
********.***************************

2. spacer 1.4|242642|38|NZ_CP010976|PILER-CR matches to NZ_CP018621 (Paenibacillus xylanexedens strain PAMC 22703 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.947 

agttattaagctgcgcaatttagttagagcttttaagc	CRISPR spacer
cgttattaagttgcgcaatttagttagagcttttaagc	Protospacer
 *********.***************************

3. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaagtccagttgctcccgtaagt	Protospacer
***** ***************** .

4. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaagtccagttgctcccgtaagt	Protospacer
***** ***************** .

5. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtaggtcccgtaact	Protospacer
************ * *********.

6. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtaggtcccgtaact	Protospacer
************ * *********.

7. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaagtccagttgctcccgtaagt	Protospacer
***** ***************** .

8. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaagtccagttgctcccgtaagt	Protospacer
***** ***************** .

9. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtaggtcccgtaact	Protospacer
************ * *********.

10. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 3, identity: 0.88 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaactccagtaggtcccgtaact	Protospacer
************ * *********.

11. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
****** ******* *********

12. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaaccccagttgctccggtaact	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
****** ******* *********

13. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NZ_CP049245 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtcactccggttgctccggtaacg	Protospacer
*** *****.**************

14. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaactccagttgctccggtaact	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
.************ ****.******

15. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaactccagttgctccggtaact	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
.************ ****.******

16. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaactccagtcactccggtaatt	Protospacer
************..*********.*

17. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
****** ******* *********

18. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 3, identity: 0.88 

ggtaactccagttgctccggtaact	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
****** ******* *********

19. spacer 5.9|2736375|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaactccagtttcacctgtaacc	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
.************** ** *****.

20. spacer 5.9|2736375|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaactccagtttcacctgtaacc	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
.************** ** *****.

21. spacer 5.13|2736654|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaaccccagttgccccagtaacc	CRISPR spacer
tgtaacaccagttggcccagtaaca	Protospacer
 ***** ******* *********

22. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
agtaactccagtaactcccgtaact	Protospacer
 *****.***** ***********.

23. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
ggtaactccagtcactccagtaact	Protospacer
 *****.*********** *****.

24. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
ggtaactccagtcactccagtaact	Protospacer
 *****.*********** *****.

25. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
ggtaactccagtcactccagtaact	Protospacer
 *****.*********** *****.

26. spacer 5.27|2737689|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaaccccagtcactcccgtaacc	CRISPR spacer
ggtaactccagtcactccagtaact	Protospacer
 *****.*********** *****.

27. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
agtaactccagtaactcccgtaact	Protospacer
..********** .***********

28. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
cgtaagtccagttgctcccgtaagt	Protospacer
 .*** ***************** *

29. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
cgtaagtccagttgctcccgtaagt	Protospacer
 .*** ***************** *

30. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
..*********** **** ******

31. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
..*********** **** ******

32. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

33. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

34. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

35. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

36. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

37. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
cgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

38. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

39. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

40. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

41. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

42. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

43. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

44. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
cgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

45. spacer 5.29|2737806|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

gataactccagttgctcccgtaact	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
 .********** * **********

46. spacer 5.31|2737914|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaaccccagtcgctccggtaacc	CRISPR spacer
ggtaactccagtcactccggtaatt	Protospacer
******.******.*********..

47. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaagtccagttgctcccgtaggt	Protospacer
***** ****************. .

48. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

49. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

50. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

51. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

52. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

53. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

54. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

55. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

56. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

57. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

58. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

59. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

60. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
 ************ **** *****.

61. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
 ************ **** *****.

62. spacer 5.32|2737968|25|NZ_CP010976|CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
agtaactccagtaactcccgtaact	Protospacer
 *********** .**********.

63. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

64. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

65. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

66. spacer 5.33|2738022|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

67. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
cgtaagtccagttgctcccgtaggt	Protospacer
***** ****************. .

68. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

69. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

70. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

71. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

72. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

73. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

74. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

75. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

76. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

77. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

78. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

79. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NZ_CP015256 (Bacillus thuringiensis Bt18247 plasmid p12509, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
tgtaactccagtaggtcccgtaact	Protospacer
.*********** * *********.

80. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
 ************ **** *****.

81. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NC_014025 (Bacillus megaterium QM B1551 plasmid pBM500, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
agtaactccagtttctccagtaact	Protospacer
 ************ **** *****.

82. spacer 5.34|2738076|25|NZ_CP010976|CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 4, identity: 0.84 

cgtaactccagttgctcccgtaacc	CRISPR spacer
agtaactccagtaactcccgtaact	Protospacer
 *********** .**********.

83. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

84. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

85. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
ggtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

86. spacer 5.35|2738130|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

tgtaaccccagttgctccggtaacc	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
 ***** ******* *********

87. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaaccccagttgctccggtaact	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
.***** ******* *********

88. spacer 5.36|2738184|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaaccccagttgctccggtaact	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
.***** ******* *********

89. spacer 5.43|2738616|25|NZ_CP010976|CRT matches to MN693809 (Marine virus AFVG_250M1103, complete genome) position: , mismatch: 4, identity: 0.84 

ggtaaccccagtcgctcccgttact	CRISPR spacer
cgtaagcgcagtcgctcccgttaca	Protospacer
 **** * ****************

90. spacer 5.47|2738877|25|NZ_CP010976|CRT matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 4, identity: 0.84 

gataactccagttgcaccggtaacc	CRISPR spacer
gatcacaccagttgcaccggtaata	Protospacer
*** ** ****************.

91. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaactccagttgctccggtaact	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
.***** ******* *********

92. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaactccagttgctccggtaact	CRISPR spacer
agtaacaccagttggtccggtaaca	Protospacer
.***** ******* *********

93. spacer 5.55|2739381|25|NZ_CP010976|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.84 

ggtaactccagttgctccggtaact	CRISPR spacer
agtatctccagttgctccggcaacg	Protospacer
.*** ***************.***

94. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

95. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

96. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

97. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

98. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

99. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

100. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 5, identity: 0.853 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcctgttgct	Protospacer
 ***************** *********** .*

101. spacer 5.53|2739255|25|NZ_CP010976|CRT matches to MT024867 (Arthrobacter phage BlueFeather, complete genome) position: , mismatch: 5, identity: 0.8 

cgttactccagtcactccgataact	CRISPR spacer
ccgcgctccagtcactccgataacg	Protospacer
*  ..*******************

102. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttactcctgttgct	Protospacer
 ***************** ***.******* .*

103. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcccgttgct	Protospacer
 ***************** ********.** .*

104. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgttgct	Protospacer
 ************.**** *********** .*

105. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgttgct	Protospacer
 ************.**** *********** .*

106. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcccgttgct	Protospacer
 ***************** ********.** .*

107. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgttgct	Protospacer
 ************.**** *********** .*

108. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttgctcccgttgct	Protospacer
 ***************** ********.** .*

109. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttactcctgttactcctgttgct	Protospacer
 ***************** ***.******* .*

110. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgttgct	Protospacer
 ************.**** *********** .*

111. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.824 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcctgttactcccgttgctcctgttgct	Protospacer
 ********.******** *********** .*

112. spacer 7.1|3841662|33|NZ_CP010976|CRT matches to NZ_CP016798 (Lactobacillus brevis strain TMW 1.2112 plasmid pl12112-1, complete sequence) position: , mismatch: 6, identity: 0.818 

ctttcttcattatttttcccccttg-gttgtcgt	CRISPR spacer
ctttcttcattatttgtcctccttatgctgtct-	Protospacer
*************** ***.****. *.****

113. spacer 10.1|5705801|27|NZ_CP010976|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778 

tcaagttggttgatcttgaaggcatat	CRISPR spacer
ccaagctggttgatcgtgaaggcaacc	Protospacer
.****.********* ********  .

114. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcccgttgctcctgttggc	Protospacer
 ************.**** *********** .

115. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgttggc	Protospacer
 ************.**** *********** .

116. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgttggc	Protospacer
 ************.**** *********** .

117. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcccgttgctcctgttggc	Protospacer
 ************.**** *********** .

118. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcctgtcggc	Protospacer
 ************.**** *********** .

119. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
cgttgctccggttactcctgttgctcctgctgct	Protospacer
 ******** ******** **********. .*

120. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
tgttgctcccgttgctcctgttgctcccattact	Protospacer
 ************.**** ********..* **

121. spacer 7.1|3841662|33|NZ_CP010976|CRT matches to MH884514 (Bacillus phage vB_BpsM-61, complete genome) position: , mismatch: 8, identity: 0.758 

ctttcttcattatttttcccccttggttgtcgt	CRISPR spacer
ttttcttcatgatctttcccccttgttactaat	Protospacer
.********* **.*********** *  * .*

122. spacer 2.20|257448|36|NZ_CP010976|PILER-CR,CRISPRCasFinder,CRT matches to NC_016562 (Campylobacter phage CPX, complete genome) position: , mismatch: 9, identity: 0.75 

agtgaatcta-----tttattgtgaaaagaaaataaagtat	CRISPR spacer
-----acctggatattttattgtaaaaacaaaataaagtat	Protospacer
     *.**.     ********.**** ************

123. spacer 5.11|2736501|34|NZ_CP010976|CRT matches to NZ_CP019235 (Bacillus thuringiensis strain YGd22-03 plasmid pYGD98, complete sequence) position: , mismatch: 9, identity: 0.735 

agttgctcccgttactccagttgctcctgtaaca	CRISPR spacer
cgtaggccccgtcactccggttgctcctgtaggt	Protospacer
 ** * .*****.*****.************.

124. spacer 7.1|3841662|33|NZ_CP010976|CRT matches to HQ634191 (Cyanophage Syn10 genomic sequence) position: , mismatch: 9, identity: 0.727 

ctttcttcattatttttcccccttggttgtcgt	CRISPR spacer
gagacttcattgtttttccctcttggttgaagc	Protospacer
    *******.********.********  *.

125. spacer 7.1|3841662|33|NZ_CP010976|CRT matches to DQ149023 (Synechococcus cyanophage syn9, complete genome) position: , mismatch: 9, identity: 0.727 

ctttcttcattatttttcccccttggttgtcgt	CRISPR spacer
gagacttcattgtttttccctcttggttgaagc	Protospacer
    *******.********.********  *.

126. spacer 7.1|3841662|33|NZ_CP010976|CRT matches to NC_008296 (Synechococcus phage syn9, complete genome) position: , mismatch: 9, identity: 0.727 

ctttcttcattatttttcccccttggttgtcgt	CRISPR spacer
gagacttcattgtttttccctcttggttgaagc	Protospacer
    *******.********.********  *.

127. spacer 2.9|256734|37|NZ_CP010976|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 10, identity: 0.73 

ccctaaactgttgcagcatggcatcaatctgttcttc	CRISPR spacer
cgcccaactgtcgcagcttggcatcaatctggttaat	Protospacer
* *. ******.***** ************* *.  .

128. spacer 4.2|710351|35|NZ_CP010976|CRISPRCasFinder matches to NC_015162 (Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence) position: , mismatch: 10, identity: 0.714 

tcgatctaacttggcttgtatcagattgtcttgcc	CRISPR spacer
ataagccttcttggcatgtatcggattgtcttgcg	Protospacer
 ..* *.  ****** ******.***********

129. spacer 5.28|2737743|34|NZ_CP010976|CRT matches to NZ_CP017721 (Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 plasmid pCFSAN017963_01, complete sequence) position: , mismatch: 10, identity: 0.706 

agttgctccggtaaccccagacgcacctgtaacc	CRISPR spacer
agttcatccggtaaccccagacgccggaacagtc	Protospacer
****  ******************    ..*..*

130. spacer 7.1|3841662|33|NZ_CP010976|CRT matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 10, identity: 0.697 

ctttcttcattatttttcccccttggttgtcgt	CRISPR spacer
ctttcttcattattttcccccattaagctattt	Protospacer
****************.**** **.. .  . *

131. spacer 4.2|710351|35|NZ_CP010976|CRISPRCasFinder matches to MK295203 (Escherichia phage vB_EcoM_005, complete genome) position: , mismatch: 11, identity: 0.686 

tcgatctaacttggcttgtatcagattgtcttgcc	CRISPR spacer
attatctaacttggcttgtttcaaattgaataaaa	Protospacer
 . **************** ***.****  * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12233 : 27751 14 Mollivirus(20.0%) NA NA
DBSCAN-SWA_2 1155937 : 1162324 7 Staphylococcus_phage(57.14%) NA NA
DBSCAN-SWA_3 2913440 : 2953882 48 Tupanvirus(13.33%) protease,portal,tRNA,terminase NA
DBSCAN-SWA_4 3296109 : 3308692 18 Aeribacillus_phage(30.77%) tail,plate NA
DBSCAN-SWA_5 3727194 : 3751322 31 Brevibacillus_phage(45.83%) portal,terminase,capsid,plate,holin,tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage