Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LK936442 Burkholderia pseudomallei strain C1 chromosome 1 2 crisprs DEDDh,DinG,csa3,cas3,WYL 0 2 8 0
NZ_LK936443 Burkholderia pseudomallei strain C1 chromosome 2 1 crisprs cas3,DinG,csa3,PD-DExK 0 0 3 0

Results visualization

1. NZ_LK936442
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LK936442_1 1122351-1122544 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LK936442_2 1446256-1446397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LK936442_1 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder 1122437-1122458 22 MF140416 Mycobacterium phage LastHope, complete genome 6359-6380 1 0.955
NZ_LK936442_1 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder 1122437-1122458 22 MT114163 Mycobacterium phage Settecandela, complete genome 64638-64659 1 0.955
NZ_LK936442_1 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder 1122437-1122458 22 MK937592 Mycobacterium phage Phrappuccino, complete genome 64638-64659 1 0.955
NZ_LK936442_1 1.1|1122383|22|NZ_LK936442|CRISPRCasFinder 1122383-1122404 22 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 379897-379918 2 0.909
NZ_LK936442_1 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder 1122437-1122458 22 NC_042031 Mycobacterium phage Anaya, complete sequence 7332-7353 2 0.909
NZ_LK936442_1 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder 1122437-1122458 22 NC_042031 Mycobacterium phage Anaya, complete sequence 7341-7362 2 0.909
NZ_LK936442_1 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder 1122437-1122458 22 MF347636 Streptomyces phage NootNoot, complete genome 102732-102753 3 0.864

1. spacer 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder matches to MF140416 (Mycobacterium phage LastHope, complete genome) position: , mismatch: 1, identity: 0.955

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgccgtcggtgc	Protospacer
************** *******

2. spacer 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 1, identity: 0.955

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgacttcggtgc	Protospacer
************ *********

3. spacer 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 1, identity: 0.955

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgacttcggtgc	Protospacer
************ *********

4. spacer 1.1|1122383|22|NZ_LK936442|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 2, identity: 0.909

atgccttcggcggcttcgatgc	CRISPR spacer
ttgcctccggcggcttcgatgc	Protospacer
 *****.***************

5. spacer 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 2, identity: 0.909

gtgccttcggtgccttcggtgc	CRISPR spacer
gtgccttcggtgccttcggtcg	Protospacer
********************  

6. spacer 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 2, identity: 0.909

gtgccttcggtgccttcggtgc	CRISPR spacer
ccgccttcggtgccttcggtgc	Protospacer
 .********************

7. spacer 1.2|1122437|22|NZ_LK936442|CRISPRCasFinder matches to MF347636 (Streptomyces phage NootNoot, complete genome) position: , mismatch: 3, identity: 0.864

gtgccttcggtgccttcggtgc	CRISPR spacer
cgaccttcggtgccttcggtgc	Protospacer
  .*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 155642 : 193232 52 Burkholderia_phage(70.0%) portal,tail,holin,capsid,terminase,head,plate NA
DBSCAN-SWA_2 979283 : 990265 10 Streptococcus_phage(16.67%) protease NA
DBSCAN-SWA_3 1612707 : 1667563 44 uncultured_Caudovirales_phage(33.33%) coat,transposase,plate NA
DBSCAN-SWA_4 2455519 : 2463707 12 Ralstonia_virus(42.86%) NA NA
DBSCAN-SWA_5 2981718 : 2990615 9 Tanapox_virus(16.67%) NA NA
DBSCAN-SWA_6 3327622 : 3336866 7 unidentified_phage(16.67%) NA NA
DBSCAN-SWA_7 3621612 : 3675741 47 Burkholderia_phage(44.44%) tail,tRNA,plate NA
DBSCAN-SWA_8 3937933 : 3949162 10 Burkholderia_phage(22.22%) integrase attL 3935138:3935155|attR 3951741:3951758
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LK936443
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LK936443_1 3008582-3008727 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 83084 : 148999 48 Ralstonia_phage(28.57%) holin,transposase,plate NA
DBSCAN-SWA_2 687964 : 759407 55 Vibrio_phage(25.0%) holin,plate NA
DBSCAN-SWA_3 2733888 : 2793172 35 Ralstonia_phage(22.22%) transposase,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage