Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009629 Burkholderia vietnamiensis LMG 10929 plasmid pBVB_1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009632 Burkholderia vietnamiensis LMG 10929 chromosome III, complete sequence 3 crisprs csa3 6 6 2 0
NZ_CP009630 Burkholderia vietnamiensis LMG 10929 chromosome II, complete sequence 0 crisprs csa3,DinG,cas3,DEDDh 0 0 1 0
NZ_CP009631 Burkholderia vietnamiensis LMG 10929 chromosome I, complete sequence 3 crisprs WYL,DinG,PD-DExK,DEDDh,csa3 0 2 230 0

Results visualization

1. NZ_CP009632
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009632_1 475819-475906 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009632_2 675689-676040 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009632_3 677318-677669 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009632_2 2.2|675849|35|NZ_CP009632|PILER-CR 675849-675883 35 NZ_CP009632.1 675078-675112 0 1.0
NZ_CP009632_2 2.2|675849|35|NZ_CP009632|PILER-CR 675849-675883 35 NZ_CP009632.1 675366-675400 0 1.0
NZ_CP009632_3 3.2|677478|35|NZ_CP009632|PILER-CR 677478-677512 35 NZ_CP009632.1 675078-675112 0 1.0
NZ_CP009632_3 3.2|677478|35|NZ_CP009632|PILER-CR 677478-677512 35 NZ_CP009632.1 675366-675400 0 1.0
NZ_CP009632_2 2.2|675849|35|NZ_CP009632|PILER-CR 675849-675883 35 NZ_CP009632.1 678720-678754 1 0.971
NZ_CP009632_3 3.2|677478|35|NZ_CP009632|PILER-CR 677478-677512 35 NZ_CP009632.1 678720-678754 1 0.971
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP009632.1 677190-677221 2 0.938
NZ_CP009632_2 2.3|675948|32|NZ_CP009632|PILER-CR 675948-675979 32 NZ_CP009632.1 677190-677221 2 0.938
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP009632.1 677190-677221 2 0.938
NZ_CP009632_3 3.3|677577|32|NZ_CP009632|PILER-CR 677577-677608 32 NZ_CP009632.1 677190-677221 2 0.938

1. spacer 2.2|675849|35|NZ_CP009632|PILER-CR matches to position: 675078-675112, mismatch: 0, identity: 1.0

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
aagtcgacagcgacgccacattgctgttcgtcgtg	Protospacer
***********************************

2. spacer 2.2|675849|35|NZ_CP009632|PILER-CR matches to position: 675366-675400, mismatch: 0, identity: 1.0

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
aagtcgacagcgacgccacattgctgttcgtcgtg	Protospacer
***********************************

3. spacer 3.2|677478|35|NZ_CP009632|PILER-CR matches to position: 675078-675112, mismatch: 0, identity: 1.0

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
aagtcgacagcgacgccacattgctgttcgtcgtg	Protospacer
***********************************

4. spacer 3.2|677478|35|NZ_CP009632|PILER-CR matches to position: 675366-675400, mismatch: 0, identity: 1.0

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
aagtcgacagcgacgccacattgctgttcgtcgtg	Protospacer
***********************************

5. spacer 2.2|675849|35|NZ_CP009632|PILER-CR matches to position: 678720-678754, mismatch: 1, identity: 0.971

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
aagtcgacagcgacaccacattgctgttcgtcgtg	Protospacer
**************.********************

6. spacer 3.2|677478|35|NZ_CP009632|PILER-CR matches to position: 678720-678754, mismatch: 1, identity: 0.971

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
aagtcgacagcgacaccacattgctgttcgtcgtg	Protospacer
**************.********************

7. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to position: 677190-677221, mismatch: 2, identity: 0.938

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgcaacgttgctgttcgtcgtg	Protospacer
************* ***********.******

8. spacer 2.3|675948|32|NZ_CP009632|PILER-CR matches to position: 677190-677221, mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgcaacgttgctgttcgtcgtg	Protospacer
******.******************.******

9. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to position: 677190-677221, mismatch: 2, identity: 0.938

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgcaacgttgctgttcgtcgtg	Protospacer
************* ***********.******

10. spacer 3.3|677577|32|NZ_CP009632|PILER-CR matches to position: 677190-677221, mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgcaacgttgctgttcgtcgtg	Protospacer
******.******************.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 15212-15243 2 0.938
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75904-75935 2 0.938
NZ_CP009632_2 2.3|675948|32|NZ_CP009632|PILER-CR 675948-675979 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75904-75935 2 0.938
NZ_CP009632_2 2.3|675948|32|NZ_CP009632|PILER-CR 675948-675979 32 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115791-115822 2 0.938
NZ_CP009632_2 2.3|675948|32|NZ_CP009632|PILER-CR 675948-675979 32 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6913-6944 2 0.938
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 15212-15243 2 0.938
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75904-75935 2 0.938
NZ_CP009632_3 3.3|677577|32|NZ_CP009632|PILER-CR 677577-677608 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75904-75935 2 0.938
NZ_CP009632_3 3.3|677577|32|NZ_CP009632|PILER-CR 677577-677608 32 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115791-115822 2 0.938
NZ_CP009632_3 3.3|677577|32|NZ_CP009632|PILER-CR 677577-677608 32 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6913-6944 2 0.938
NZ_CP009632_2 2.2|675849|35|NZ_CP009632|PILER-CR 675849-675883 35 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75901-75935 3 0.914
NZ_CP009632_3 3.2|677478|35|NZ_CP009632|PILER-CR 677478-677512 35 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75901-75935 3 0.914
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 95947-95978 4 0.875
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 73870-73901 4 0.875
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 95947-95978 4 0.875
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 73870-73901 4 0.875
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 151975-152006 8 0.75
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP020883 Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence 105845-105876 8 0.75
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP020886 Xanthomonas citri pv. citri strain TX160149 plasmid unnamed1, complete sequence 69518-69549 8 0.75
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 152159-152190 8 0.75
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP021016 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pF, complete sequence 24124-24155 8 0.75
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP020890 Xanthomonas citri pv. citri strain TX160197 plasmid unnamed1, complete sequence 20655-20686 8 0.75
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 151975-152006 8 0.75
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP020883 Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence 105845-105876 8 0.75
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP020886 Xanthomonas citri pv. citri strain TX160149 plasmid unnamed1, complete sequence 69518-69549 8 0.75
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 152159-152190 8 0.75
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP021016 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pF, complete sequence 24124-24155 8 0.75
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP020890 Xanthomonas citri pv. citri strain TX160197 plasmid unnamed1, complete sequence 20655-20686 8 0.75
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP035572 Lactobacillus plantarum strain SRCM103303 plasmid unnamed1 5213-5244 10 0.688
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP021931 Lactobacillus plantarum strain TMW 1.1308 plasmid pL11308-1, complete sequence 45731-45762 10 0.688
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP035570 Lactobacillus plantarum strain SRCM103300 plasmid unnamed4 824-855 10 0.688
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 53865-53896 10 0.688
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP013150 Lactobacillus plantarum strain MF1298 plasmid pMF1298-1, complete sequence 60828-60859 10 0.688
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP050806 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP752, complete sequence 757-788 10 0.688
NZ_CP009632_2 2.3|675948|32|NZ_CP009632|PILER-CR 675948-675979 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 53865-53896 10 0.688
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP035572 Lactobacillus plantarum strain SRCM103303 plasmid unnamed1 5213-5244 10 0.688
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP021931 Lactobacillus plantarum strain TMW 1.1308 plasmid pL11308-1, complete sequence 45731-45762 10 0.688
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP035570 Lactobacillus plantarum strain SRCM103300 plasmid unnamed4 824-855 10 0.688
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 53865-53896 10 0.688
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP013150 Lactobacillus plantarum strain MF1298 plasmid pMF1298-1, complete sequence 60828-60859 10 0.688
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP050806 Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP752, complete sequence 757-788 10 0.688
NZ_CP009632_3 3.3|677577|32|NZ_CP009632|PILER-CR 677577-677608 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 53865-53896 10 0.688
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP035557 Lactobacillus plantarum strain SRCM103297 plasmid unnamed1 18396-18427 11 0.656
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP035557 Lactobacillus plantarum strain SRCM103297 plasmid unnamed1 60709-60740 11 0.656
NZ_CP009632_2 2.1|675753|32|NZ_CP009632|PILER-CR 675753-675784 32 NZ_CP028242 Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence 21395-21426 11 0.656
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP035557 Lactobacillus plantarum strain SRCM103297 plasmid unnamed1 18396-18427 11 0.656
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP035557 Lactobacillus plantarum strain SRCM103297 plasmid unnamed1 60709-60740 11 0.656
NZ_CP009632_3 3.1|677382|32|NZ_CP009632|PILER-CR 677382-677413 32 NZ_CP028242 Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence 21395-21426 11 0.656

1. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tggacaacgacgccacgttgctgttcgtcgtg	Protospacer
* ***********************.******

2. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgccacgttgctgttcgtcgtg	Protospacer
******.******************.******

3. spacer 2.3|675948|32|NZ_CP009632|PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgccacgttgctgttcgtcgtg	Protospacer
************* ***********.******

4. spacer 2.3|675948|32|NZ_CP009632|PILER-CR matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgcgacgttgctgttggtcgtg	Protospacer
*************.*********** ******

5. spacer 2.3|675948|32|NZ_CP009632|PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgcgacgttgctgttggtcgtg	Protospacer
*************.*********** ******

6. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tggacaacgacgccacgttgctgttcgtcgtg	Protospacer
* ***********************.******

7. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgccacgttgctgttcgtcgtg	Protospacer
******.******************.******

8. spacer 3.3|677577|32|NZ_CP009632|PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgccacgttgctgttcgtcgtg	Protospacer
************* ***********.******

9. spacer 3.3|677577|32|NZ_CP009632|PILER-CR matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgcgacgttgctgttggtcgtg	Protospacer
*************.*********** ******

10. spacer 3.3|677577|32|NZ_CP009632|PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcgacagcgacgcgacgttgctgttggtcgtg	Protospacer
*************.*********** ******

11. spacer 2.2|675849|35|NZ_CP009632|PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.914

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
cggtcgacagcgacgccacgttgctgttcgtcgtg	Protospacer
 .*****************.***************

12. spacer 3.2|677478|35|NZ_CP009632|PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.914

aagtcgacagcgacgccacattgctgttcgtcgtg	CRISPR spacer
cggtcgacagcgacgccacgttgctgttcgtcgtg	Protospacer
 .*****************.***************

13. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 4, identity: 0.875

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgccacgttgctgctcgtgttg	Protospacer
***********************.*.**  **

14. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 4, identity: 0.875

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgccacgttgctgctcgtgttg	Protospacer
***********************.*.**  **

15. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 4, identity: 0.875

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgccacgttgctgctcgtgttg	Protospacer
***********************.*.**  **

16. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 4, identity: 0.875

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgacaacgacgccacgttgctgctcgtgttg	Protospacer
***********************.*.**  **

17. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgaccacgacgccacggtgctgacttacctc	Protospacer
***** *********** ***** .*  * * 

18. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP020883 (Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

19. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP020886 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

20. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgaccacgacgccacggtgctgacttacctc	Protospacer
***** *********** ***** .*  * * 

21. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP021016 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pF, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

22. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP020890 (Xanthomonas citri pv. citri strain TX160197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

23. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgaccacgacgccacggtgctgacttacctc	Protospacer
***** *********** ***** .*  * * 

24. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP020883 (Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

25. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP020886 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

26. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcgaccacgacgccacggtgctgacttacctc	Protospacer
***** *********** ***** .*  * * 

27. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP021016 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pF, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

28. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP020890 (Xanthomonas citri pv. citri strain TX160197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcgacaacgacgccacgttgctgt-ttgtcgtg	CRISPR spacer
gcgacgacgacgccacgatgctgtaccggcgg-	Protospacer
 ****.*********** ****** ..* **  

29. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP035572 (Lactobacillus plantarum strain SRCM103303 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

30. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP021931 (Lactobacillus plantarum strain TMW 1.1308 plasmid pL11308-1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

31. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP035570 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed4) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

32. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcggcagcgacgccacgttgctgagctccagc	Protospacer
***.**.****************  . .*.  

33. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP013150 (Lactobacillus plantarum strain MF1298 plasmid pMF1298-1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

34. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP050806 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP752, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

35. spacer 2.3|675948|32|NZ_CP009632|PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcggcagcgacgccacgttgctgagctccagc	Protospacer
***.********* *********  . .*.  

36. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP035572 (Lactobacillus plantarum strain SRCM103303 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

37. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP021931 (Lactobacillus plantarum strain TMW 1.1308 plasmid pL11308-1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

38. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP035570 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed4) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

39. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
tcggcagcgacgccacgttgctgagctccagc	Protospacer
***.**.****************  . .*.  

40. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP013150 (Lactobacillus plantarum strain MF1298 plasmid pMF1298-1, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

41. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP050806 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP752, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ccaccaatgacgccaagttgctgtttgagtaa	Protospacer
.*. ***.******* ***********    .

42. spacer 3.3|677577|32|NZ_CP009632|PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 10, identity: 0.688

tcgacagcgacgcaacgttgctgtttgtcgtg	CRISPR spacer
tcggcagcgacgccacgttgctgagctccagc	Protospacer
***.********* *********  . .*.  

43. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP035557 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed1) position: , mismatch: 11, identity: 0.656

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ctaccaatgacgccaagttgctgtttgagtaa	Protospacer
... ***.******* ***********    .

44. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP035557 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed1) position: , mismatch: 11, identity: 0.656

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ctaccaatgacgccaagttgctgtttgagtaa	Protospacer
... ***.******* ***********    .

45. spacer 2.1|675753|32|NZ_CP009632|PILER-CR matches to NZ_CP028242 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ctaccaatgacgccaagttgctgtttgagtaa	Protospacer
... ***.******* ***********    .

46. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP035557 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed1) position: , mismatch: 11, identity: 0.656

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ctaccaatgacgccaagttgctgtttgagtaa	Protospacer
... ***.******* ***********    .

47. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP035557 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed1) position: , mismatch: 11, identity: 0.656

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ctaccaatgacgccaagttgctgtttgagtaa	Protospacer
... ***.******* ***********    .

48. spacer 3.1|677382|32|NZ_CP009632|PILER-CR matches to NZ_CP028242 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

tcgacaacgacgccacgttgctgtttgtcgtg	CRISPR spacer
ctaccaatgacgccaagttgctgtttgagtaa	Protospacer
... ***.******* ***********    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29642 : 64828 24 uncultured_Caudovirales_phage(25.0%) integrase,transposase attL 21439:21454|attR 38839:38854
DBSCAN-SWA_2 584019 : 650269 71 uncultured_Caudovirales_phage(35.71%) integrase,transposase attL 583868:583899|attR 660514:660528
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009630
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 784493 : 834790 38 Paenibacillus_phage(20.0%) plate,integrase,tRNA,transposase attL 777120:777139|attR 787007:787026
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009631
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009631_1 18488-18584 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009631_2 980997-981127 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009631_3 2578335-2578517 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009631_1 1.1|18516|41|NZ_CP009631|CRISPRCasFinder 18516-18556 41 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 223412-223452 9 0.78
NZ_CP009631_1 1.1|18516|41|NZ_CP009631|CRISPRCasFinder 18516-18556 41 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 223541-223581 9 0.78
NZ_CP009631_2 2.2|981074|31|NZ_CP009631|CRISPRCasFinder 981074-981104 31 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 384995-385025 10 0.677

1. spacer 1.1|18516|41|NZ_CP009631|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.78

caccagcgttgcccaatgcgccggtcaccgtgccgagtgct	CRISPR spacer
cgccgacgttgcccagagcgccggtcaccgtgccgaccacg	Protospacer
*.**..*********. ******************* ..* 

2. spacer 1.1|18516|41|NZ_CP009631|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.78

caccagcgttgcccaatgcgccggtcaccgtgccgagtgct	CRISPR spacer
cgccgacgttgcccagagcgccggtcaccgtgccgaccacg	Protospacer
*.**..*********. ******************* ..* 

3. spacer 2.2|981074|31|NZ_CP009631|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677

atccgacccatccatcgcatccgacccatcc	CRISPR spacer
tgccgacacatccatcgcatcggacgtggtg	Protospacer
  ***** ************* *** .. . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2257 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 5669 : 6701 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_3 11331 : 13312 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_4 21367 : 22807 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_5 34276 : 46866 9 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_6 67384 : 68632 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_7 79663 : 95080 14 Wolbachia_phage(12.5%) tRNA NA
DBSCAN-SWA_8 109734 : 113584 3 Acanthocystis_turfacea_chlorella_virus(50.0%) protease NA
DBSCAN-SWA_9 124203 : 124692 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_10 127752 : 128712 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 132587 : 137449 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_12 162949 : 167197 4 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_13 172046 : 172418 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_14 184683 : 185409 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_15 191098 : 192487 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_16 198869 : 204580 4 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_17 216854 : 217271 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_18 223650 : 224151 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_19 228345 : 231819 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_20 253313 : 257878 2 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_21 266278 : 270590 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_22 279743 : 280202 1 Rhizoctonia_fumigata_mycovirus(100.0%) NA NA
DBSCAN-SWA_23 287249 : 287756 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_24 308311 : 312197 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_25 328642 : 334144 6 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_26 342910 : 416799 58 Acinetobacter_phage(14.29%) transposase,plate,tRNA NA
DBSCAN-SWA_27 424050 : 435689 12 Pseudomonas_phage(40.0%) protease,integrase attL 427335:427349|attR 436859:436873
DBSCAN-SWA_28 440236 : 442373 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_29 454306 : 455233 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_30 458785 : 459607 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_31 474975 : 476861 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_32 516115 : 531330 7 Klosneuvirus(20.0%) NA NA
DBSCAN-SWA_33 535331 : 536522 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_34 560720 : 561407 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_35 574451 : 575150 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_36 586102 : 588672 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_37 600372 : 601791 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_38 613359 : 618596 5 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_39 644318 : 647114 2 Organic_Lake_phycodnavirus(50.0%) transposase NA
DBSCAN-SWA_40 650398 : 652486 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_41 658454 : 661382 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 681842 : 684407 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_43 702700 : 704428 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_44 713967 : 715672 2 Bifidobacterium_phage(50.0%) NA NA
DBSCAN-SWA_45 718846 : 721386 2 Pithovirus(50.0%) NA NA
DBSCAN-SWA_46 728845 : 731764 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_47 747653 : 749975 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_48 774937 : 775735 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_49 780521 : 785566 2 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_50 807058 : 807856 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_51 813395 : 814226 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_52 819195 : 826091 6 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_53 830410 : 831769 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_54 835533 : 836625 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_55 845563 : 854399 7 Paramecium_bursaria_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_56 861892 : 863806 3 Vibrio_phage(66.67%) NA NA
DBSCAN-SWA_57 876830 : 878782 2 Phaeocystis_globosa_virus(50.0%) NA NA
DBSCAN-SWA_58 892840 : 894184 1 Erwinia_phage(100.0%) protease NA
DBSCAN-SWA_59 898419 : 903545 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_60 912464 : 914105 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_61 925357 : 926383 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_62 936657 : 937965 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_63 942112 : 944124 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_64 949710 : 954725 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_65 967181 : 968171 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_66 972786 : 974094 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_67 988777 : 990929 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_68 1001522 : 1005908 3 Paramecium_bursaria_Chlorella_virus(33.33%) tRNA NA
DBSCAN-SWA_69 1024194 : 1025127 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_70 1053402 : 1054614 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_71 1058250 : 1058928 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_72 1068126 : 1069908 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_73 1073343 : 1074411 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_74 1083221 : 1083707 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_75 1090163 : 1091072 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_76 1095872 : 1099472 4 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_77 1103064 : 1107602 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_78 1128906 : 1130679 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_79 1134731 : 1134992 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_80 1142110 : 1143718 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_81 1151076 : 1152645 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_82 1155983 : 1169758 7 Streptomyces_phage(25.0%) NA NA
DBSCAN-SWA_83 1173854 : 1175720 2 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_84 1182346 : 1186888 6 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_85 1193256 : 1194165 1 Corynebacterium_phage(100.0%) NA NA
DBSCAN-SWA_86 1198231 : 1213577 14 Brazilian_cedratvirus(14.29%) NA NA
DBSCAN-SWA_87 1230095 : 1230812 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_88 1250992 : 1251817 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_89 1261551 : 1266792 5 Tetraselmis_virus(33.33%) tRNA NA
DBSCAN-SWA_90 1283580 : 1285452 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_91 1307831 : 1314549 6 Pseudomonas_phage(33.33%) tRNA NA
DBSCAN-SWA_92 1318912 : 1319692 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_93 1323422 : 1324883 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_94 1328531 : 1329680 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_95 1341481 : 1341799 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_96 1344878 : 1351447 9 Xanthomonas_phage(25.0%) integrase attL 1346672:1346687|attR 1358236:1358251
DBSCAN-SWA_97 1354496 : 1358052 3 Hokovirus(33.33%) NA NA
DBSCAN-SWA_98 1362008 : 1362713 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_99 1368454 : 1371142 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_100 1384464 : 1388214 4 Mollivirus(50.0%) NA NA
DBSCAN-SWA_101 1393427 : 1396353 2 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_102 1407666 : 1409043 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_103 1412963 : 1413851 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_104 1422115 : 1423979 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_105 1437630 : 1450289 12 Orpheovirus(16.67%) tRNA NA
DBSCAN-SWA_106 1453708 : 1454638 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_107 1462078 : 1464279 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_108 1477192 : 1482815 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_109 1488127 : 1500929 11 Lake_Baikal_phage(14.29%) tRNA,protease NA
DBSCAN-SWA_110 1516462 : 1519775 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_111 1526451 : 1528250 2 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_112 1535247 : 1535823 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_113 1540621 : 1547841 8 Agrobacterium_phage(33.33%) integrase attL 1531204:1531218|attR 1556085:1556099
DBSCAN-SWA_114 1554639 : 1555956 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_115 1559636 : 1561148 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_116 1568809 : 1569607 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_117 1577941 : 1578601 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_118 1587657 : 1589823 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_119 1593069 : 1593639 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_120 1596930 : 1597614 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_121 1612925 : 1617375 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_122 1621245 : 1622025 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_123 1625725 : 1626451 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_124 1630342 : 1631689 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_125 1634839 : 1635418 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_126 1641258 : 1647855 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_127 1651532 : 1653872 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_128 1660309 : 1662208 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_129 1667733 : 1668687 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_130 1682799 : 1687605 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_131 1690947 : 1698331 4 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) tRNA NA
DBSCAN-SWA_132 1704590 : 1706372 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_133 1724525 : 1726610 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_134 1736778 : 1737414 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_135 1740456 : 1754462 15 Enterococcus_phage(20.0%) NA NA
DBSCAN-SWA_136 1780063 : 1780654 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_137 1821838 : 1825744 3 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_138 1834341 : 1842391 5 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_139 1852293 : 1853817 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_140 1866242 : 1870427 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_141 1879700 : 1881845 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_142 1885333 : 1888570 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_143 1896876 : 1898649 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_144 1907457 : 1928968 19 Lake_Baikal_phage(18.18%) tRNA NA
DBSCAN-SWA_145 1940111 : 1940888 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_146 1944568 : 1947226 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_147 1953464 : 1957014 4 Bodo_saltans_virus(33.33%) tRNA NA
DBSCAN-SWA_148 1963153 : 1965940 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_149 1985048 : 1988477 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_150 1999600 : 2001151 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_151 2007603 : 2013226 5 Yellowstone_lake_mimivirus(33.33%) NA NA
DBSCAN-SWA_152 2025823 : 2028429 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_153 2037715 : 2038498 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_154 2048603 : 2056010 7 Emiliania_huxleyi_virus(33.33%) NA NA
DBSCAN-SWA_155 2062015 : 2067110 5 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_156 2098535 : 2099261 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_157 2104046 : 2105267 1 Enterobacteria_phage(100.0%) integrase attL 2097748:2097764|attR 2108646:2108662
DBSCAN-SWA_158 2114842 : 2124991 7 Agrobacterium_phage(20.0%) transposase,protease NA
DBSCAN-SWA_159 2130009 : 2146204 12 Burkholderia_phage(20.0%) NA NA
DBSCAN-SWA_160 2158797 : 2159760 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_161 2163332 : 2163953 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_162 2168354 : 2169530 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_163 2176869 : 2206599 30 Sinorhizobium_phage(33.33%) transposase,integrase NA
DBSCAN-SWA_164 2216101 : 2219183 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_165 2223002 : 2224025 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_166 2236223 : 2238821 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_167 2247749 : 2248865 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_168 2258121 : 2272595 14 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_169 2286766 : 2290927 3 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_170 2294904 : 2297154 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_171 2314835 : 2319672 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_172 2329577 : 2331621 2 Ralstonia_phage(50.0%) integrase attL 2319547:2319606|attR 2331664:2331801
DBSCAN-SWA_173 2345467 : 2347201 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_174 2358620 : 2360707 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_175 2370123 : 2373282 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_176 2382793 : 2385104 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_177 2448244 : 2465029 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_178 2469365 : 2470217 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_179 2473888 : 2480622 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_180 2485696 : 2503171 12 Burkholderia_virus(16.67%) NA NA
DBSCAN-SWA_181 2506464 : 2510063 5 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_182 2515506 : 2518393 4 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_183 2526261 : 2527227 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_184 2542426 : 2548970 3 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_185 2557194 : 2558949 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_186 2582933 : 2584364 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_187 2596233 : 2648624 52 Bodo_saltans_virus(11.11%) transposase,tRNA,integrase attL 2606533:2606548|attR 2632641:2632656
DBSCAN-SWA_188 2656081 : 2718201 49 Escherichia_phage(22.22%) transposase,tRNA,integrase attL 2655014:2655029|attR 2689113:2689128
DBSCAN-SWA_189 2735240 : 2736341 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_190 2743563 : 2744391 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_191 2750769 : 2761365 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_192 2775353 : 2776928 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2785380 : 2786831 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_194 2793103 : 2800930 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_195 2837893 : 2839906 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_196 2852088 : 2854200 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_197 2857835 : 2862625 4 Klosneuvirus(50.0%) transposase NA
DBSCAN-SWA_198 2866889 : 2867588 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_199 2877130 : 2888538 10 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_200 2895233 : 2905128 9 Halovirus(16.67%) NA NA
DBSCAN-SWA_201 2919763 : 2920519 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_202 2927470 : 2934844 6 Burkholderia_virus(66.67%) NA NA
DBSCAN-SWA_203 2944814 : 2947346 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_204 2952535 : 2953567 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_205 2965907 : 2971960 2 Virus_Rctr197k(50.0%) NA NA
DBSCAN-SWA_206 2995014 : 2996538 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_207 3012109 : 3012910 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_208 3033729 : 3035562 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_209 3046285 : 3050038 4 Burkholderia_virus(33.33%) transposase NA
DBSCAN-SWA_210 3062203 : 3068227 5 Micromonas_pusilla_virus(33.33%) protease NA
DBSCAN-SWA_211 3072570 : 3073704 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_212 3092324 : 3096817 4 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_213 3110335 : 3117716 8 Escherichia_phage(33.33%) protease NA
DBSCAN-SWA_214 3133421 : 3145210 12 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_215 3151338 : 3155883 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_216 3170908 : 3172204 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_217 3179110 : 3180115 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_218 3187660 : 3188674 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_219 3195527 : 3197019 2 Croceibacter_phage(50.0%) NA NA
DBSCAN-SWA_220 3200612 : 3203988 3 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_221 3219416 : 3231905 10 Bacillus_virus(33.33%) tRNA NA
DBSCAN-SWA_222 3235614 : 3247252 10 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_223 3255942 : 3258820 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_224 3270520 : 3271177 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_225 3276200 : 3277755 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_226 3286827 : 3288222 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_227 3291745 : 3292768 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_228 3298988 : 3303403 4 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_229 3310967 : 3311924 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_230 3316268 : 3317174 1 Escherichia_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage