Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010803 Martelella endophytica strain YC6887 chromosome, complete genome 1 crisprs cas3,csa3,DEDDh 1 0 7 0

Results visualization

1. NZ_CP010803
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010803_1 1679857-1679964 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP010803_1 1.1|1679884|54|NZ_CP010803|CRISPRCasFinder 1679884-1679937 54 NZ_CP010803.1 1679722-1679775 1 0.981

1. spacer 1.1|1679884|54|NZ_CP010803|CRISPRCasFinder matches to position: 1679722-1679775, mismatch: 1, identity: 0.981

gtcgcataggcattgctgatcgtgccagaagtgttgtacccgaccagcccgccg	CRISPR spacer
gtcgcataggcattgctgatcgtgccagaagtgttgtacccgaccaacccgccg	Protospacer
**********************************************.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 341433 : 376260 46 Sinorhizobium_phage(29.03%) portal,tail,integrase,head,protease,terminase,capsid attL 343783:343798|attR 381970:381985
DBSCAN-SWA_2 2933226 : 3012484 90 Ochrobactrum_phage(20.69%) tail,plate,head,terminase,tRNA,transposase NA
DBSCAN-SWA_3 3569830 : 3579894 8 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_4 3715789 : 3798009 85 Sinorhizobium_phage(40.0%) portal,tail,integrase,head,terminase,capsid,tRNA,transposase attL 3751969:3752001|attR 3799310:3799342
DBSCAN-SWA_5 3902389 : 3915385 13 uncultured_Mediterranean_phage(81.82%) tRNA NA
DBSCAN-SWA_6 3974482 : 4038273 60 Paracoccus_phage(11.76%) portal,tail,head,protease,capsid,tRNA NA
DBSCAN-SWA_7 4396996 : 4403416 8 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage