1. spacer 1.7|2182264|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO538766 (Magnetospira sp. QH-2 plasmid MGMAQ_p, complete sequence) position: , mismatch: 0, identity: 1.0
attgcgggatacaaggccatagcgccttgcacaa CRISPR spacer
attgcgggatacaaggccatagcgccttgcacaa Protospacer
**********************************
2. spacer 1.28|2183638|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO538766 (Magnetospira sp. QH-2 plasmid MGMAQ_p, complete sequence) position: , mismatch: 0, identity: 1.0
ggtccaggtgcgtaaggtctgctgcggatctgt CRISPR spacer
ggtccaggtgcgtaaggtctgctgcggatctgt Protospacer
*********************************
3. spacer 1.29|2183702|36|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO538766 (Magnetospira sp. QH-2 plasmid MGMAQ_p, complete sequence) position: , mismatch: 0, identity: 1.0
atccagatcaaggacgggaggggggcgaaaatttgc CRISPR spacer
atccagatcaaggacgggaggggggcgaaaatttgc Protospacer
************************************
4. spacer 1.37|2184226|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_FO538766 (Magnetospira sp. QH-2 plasmid MGMAQ_p, complete sequence) position: , mismatch: 0, identity: 1.0
ggcaacggggcgggcaaaaagggcctgctcgccg CRISPR spacer
ggcaacggggcgggcaaaaagggcctgctcgccg Protospacer
**********************************
5. spacer 1.27|2183573|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 5, identity: 0.853
ccagcatagatgatagcccaggcccaaggctgtc CRISPR spacer
ttggcgtagatgatagcccatgcccaaggctgtc Protospacer
...**.************** *************
6. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to CP021184 (Sphingomonas wittichii DC-6 plasmid pDC03, complete sequence) position: , mismatch: 6, identity: 0.824
-tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gtccggc-cgggatgccgacagcggcatggaccag Protospacer
**** * *********** ********** **.
7. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
cccgccggtcagcacatcgtcgccgtcgccg Protospacer
**.******** **************...*
8. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
ggaaccgggcagaacctcgtcgccgtcaacg Protospacer
* ***** ****** ************ .*
9. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gcccccggtcagcacatcgtcgccggtaccg Protospacer
*** ******** ************ .*..*
10. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gcccccggtcagcacatcgtcgccggtaccg Protospacer
*** ******** ************ .*..*
11. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg-- CRISPR spacer
cccaccgctcagaccatcgtcgccg--agtggt Protospacer
****** ***** *********** * **
12. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcgccggtcagcagatcgtcgccgtcggtg Protospacer
*.*.******** * ************. **
13. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcaccggccagaccatcgtcgccgacggtg Protospacer
*.******.**** *********** *. **
14. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcaccggccagaccatcgtcgccgacggtg Protospacer
*.******.**** *********** *. **
15. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcaccggccagaccatcgtcgccgacggtg Protospacer
*.******.**** *********** *. **
16. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcaccggccagaccatcgtcgccgacggtg Protospacer
*.******.**** *********** *. **
17. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcgccggtcagaagatcgtcaccgtccatg Protospacer
*.*.********** ******.***** **
18. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.806
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcgccggtcagaagatcgtcaccgtccatg Protospacer
*.*.********** ******.***** **
19. spacer 1.13|2182660|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
tcgatctgggcctgccagtcagccatgcgaccgg CRISPR spacer
tcgatctgggcctgcccgtcaccctgggctccgg Protospacer
**************** **** ** * ****
20. spacer 1.19|2183050|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.788
cgtggagcgccacgggggaggggccggactcgt CRISPR spacer
cggacagcgcaccgggggaggggccggacctgt Protospacer
** . ***** *****************..**
21. spacer 1.19|2183050|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.788
cgtggagcgccacgggggaggggccggactcgt CRISPR spacer
cggacagcgcaccgggggaggggccggacctgt Protospacer
** . ***** *****************..**
22. spacer 1.19|2183050|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.788
cgtggagcgccacgggggaggggccggactcgt CRISPR spacer
cggacagcgcaccgggggaggggccggacctgt Protospacer
** . ***** *****************..**
23. spacer 1.27|2183573|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.794
ccagcatagatgatagcccaggcccaaggctgtc CRISPR spacer
ttggcgcagatgatagcccatgcccaaggttgtc Protospacer
...**..************* ********.****
24. spacer 1.27|2183573|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ccagcatagatgatagcccaggcccaaggctgtc CRISPR spacer
ttggcgcagatgatagcccatgcccaaggttgtc Protospacer
...**..************* ********.****
25. spacer 1.30|2183769|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.794
acaacggtctcgccgttcttgcggacgtggatgg CRISPR spacer
acagcctcttcggcgttcttgcggacatggatgg Protospacer
***.* ..*** *************.*******
26. spacer 1.32|2183900|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 7, identity: 0.788
tcaagtgcccgcgcctggtcgagaaggtgacgg CRISPR spacer
ccaacgtctcgcgcctggtcgagaggatgacgg Protospacer
.*** *.***************.*.******
27. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.774
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
accgccggtcagaacgtcgtcgccgttgccg Protospacer
.**.***********.**********....*
28. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
accgccggtcagaacgtcgtcgccgttgccg Protospacer
.**.***********.**********....*
29. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 7, identity: 0.774
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
accgccggtcagaacgtcgtcgccgttgccg Protospacer
.**.***********.**********....*
30. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcaccggccagaccatcgtcgccgacggcg Protospacer
*.******.**** *********** *. .*
31. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcaccggccagaccatcgtcgccgacggag Protospacer
*.******.**** *********** *. *
32. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MK291445 (Paracoccus phage vB_PyeM_Pyei1, complete genome) position: , mismatch: 7, identity: 0.774
gccaccggtcagaacatcgtcgccgtcattg- CRISPR spacer
cccaccgatcaggacatcgtcgcc-ccagcgc Protospacer
******.****.*********** .** .*
33. spacer 1.1|2181869|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758
ccaaatccccgccgacggccgcccgcacggctt CRISPR spacer
cgccggccccgccgtcggccgcccgcatggcgt Protospacer
* . ******** ************.*** *
34. spacer 1.1|2181869|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 8, identity: 0.758
ccaaatccccgccgacggccgcccgcacggctt CRISPR spacer
cgtcgaccccgcccacggccgccggcacggcgt Protospacer
* . ******* ********* ******* *
35. spacer 1.3|2182000|36|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 8, identity: 0.778
gagacggtgcgcccggtggtggtggtggcggtgtcg CRISPR spacer
cggcggggccgcccggtgctggtgggggcggtgtcg Protospacer
.* ** ********* ****** **********
36. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039698 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK23, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
37. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039698 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK23, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
38. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020541 (Sphingobium herbicidovorans strain MH plasmid pSHV2, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
39. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to CP021188 (Sphingomonas wittichii DC-6 plasmid pDC07, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
40. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016454 (Sphingobium sp. RAC03 plasmid pBSY17_4, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
41. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
42. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
cccctgccgggatgccgacagcggcatggaccag Protospacer
.** * *********** ********** **.
43. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053225 (Sphingobium sp. RSMS plasmid pRSMS2, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
44. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015989 (Sphingobium sp. EP60837 plasmid pEP2, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
45. spacer 1.9|2182398|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015989 (Sphingobium sp. EP60837 plasmid pEP2, complete sequence) position: , mismatch: 8, identity: 0.765
tccgtcgcgggatgccgaaagcggcatggtccgc CRISPR spacer
gccctgccgggatgccgacagcggcatggaccag Protospacer
** * *********** ********** **.
46. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
47. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
48. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
49. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
50. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
51. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgttgcggc Protospacer
*.* ** . ******** ********** ****.
52. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgttgcggc Protospacer
*.* ** . ******** ********** ****.
53. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
54. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
55. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
56. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
57. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
58. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
tgta-gccaccgcaaaccccgaccgccgtggcggt CRISPR spacer
-gcacgcagacgcaaaccacgaccgccgtcgcggc Protospacer
*.* ** . ******** ********** ****.
59. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tggcggacatggtcaacctgttcgacccggaga Protospacer
** *****.*.*****************.
60. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to MN119376 (Streptomyces phage Geostin, complete genome) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tcgcctccatgtccgtcctgttcgacggctggg Protospacer
********** *** ********** .**
61. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to MH155868 (Streptomyces phage FlowerPower, complete genome) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tcgcctccatgtccgtcctgttcgacggctggg Protospacer
********** *** ********** .**
62. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to MN284894 (Streptomyces phage Fabian, complete genome) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tcgcctccatgtccgtcctgttcgacggctggg Protospacer
********** *** ********** .**
63. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg----- CRISPR spacer
gtgcctccatggccgaccagtacgacc-----gcctct Protospacer
*.**************** ** ***** *
64. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tggcggacatggtcaacctgttcgacccggaga Protospacer
** *****.*.*****************.
65. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009453 (Sphingopyxis sp. 113P3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tcgtcgagatagccgtcctgttcgacccggagc Protospacer
**.* **.**** ****************
66. spacer 1.32|2183900|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
tcaagtgcccgcgcctggtcgagaaggtgacgg CRISPR spacer
tggtggtgccgcgcttggacgagaaggtgacgg Protospacer
* . * ******.*** **************
67. spacer 1.38|2184291|34|NZ_FO538765|CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.765
----ctgaaaagcgtcaaggcgtgccgggccatgttcc CRISPR spacer
cgtcctga----cgtcaaggcgtgcggggccgtgttgt Protospacer
**** ************* *****.**** .
68. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 8, identity: 0.742
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
caggccggtcagaaaatcgacgccgtcatcc Protospacer
.********** **** *********.
69. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 8, identity: 0.742
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
cccgccggtcagaacatcgacgccgacgccc Protospacer
**.*************** ***** *...
70. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 8, identity: 0.742
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gtcgccggtcagatcgtcgtcgccgtcgcca Protospacer
*.*.********* *.***********....
71. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 8, identity: 0.742
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gccaccgggcagcacatcgtcgcgatagatc Protospacer
******** *** ********** .* . *
72. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 8, identity: 0.742
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
gccaccgggcagcacatcgtcgcgatagatc Protospacer
******** *** ********** .* . *
73. spacer 1.3|2182000|36|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to KJ944830 (Pseudoalteromonas phage B8b, partial genome) position: , mismatch: 9, identity: 0.75
gagacggtgcgcccggtggtggtggtggcggtgtcg CRISPR spacer
ctgctgctgcgcccggtggtggtggtggtgctgttt Protospacer
* .* *********************.* ***.
74. spacer 1.11|2182528|35|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
cgtccactgcggacaaggtcgctcaggccgctgcc CRISPR spacer
ccgacaccgccgacaaggtcgctcaggccgcactg Protospacer
* ***.** ******************** .
75. spacer 1.11|2182528|35|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
cgtccactgcggacaaggtcgctcaggccgctgcc CRISPR spacer
ccgacaccgccgacaaggtcgctcaggccgcactg Protospacer
* ***.** ******************** .
76. spacer 1.15|2182789|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
tgtagcca-----ccgcaaaccccgaccgccgtggcggt CRISPR spacer
-----ccgtcttcctgcaaagctcgaccgccgtggcggt Protospacer
**. *.***** *.****************
77. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_009982 (Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK3, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
78. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to JN581942 (Uncultured bacterium plasmid pHH2-227, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
79. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
tgaactccatgggcgacctgttccacccccggg Protospacer
. ******** ********** **** .**
80. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_028464 (Escherichia coli plasmid R388 DNA, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
81. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_010716 (Salmonella enterica subsp. enterica serovar Dublin plasmid IncW pIE321, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
82. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018350 (Enterobacter hormaechei strain TUM10660 plasmid pMTY10660_IncW, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
83. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_010643 (Providencia rettgeri plasmid R7K, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
84. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH882484 (Providencia rettgeri strain 2055 plasmid p2055-IMP, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
85. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
gcatgtctatcgccgacctgttcgacccgtgca Protospacer
**.. **.** ****************** . .
86. spacer 1.30|2183769|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.735
acaacggtctcgccgttcttgcggacgtggatgg CRISPR spacer
cccagaagctcgccggtcttgcggtcgtggatga Protospacer
* * .. ******* ******** ********.
87. spacer 1.38|2184291|34|NZ_FO538765|CRT matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 9, identity: 0.735
ctgaaaagcgtcaaggcgtgccgggccatgttcc CRISPR spacer
cagcctcgcgtcaaggcgtgcggggccgtgtcct Protospacer
* * ************** *****.***.*.
88. spacer 1.38|2184291|34|NZ_FO538765|CRT matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 9, identity: 0.735
ctgaaaagcgtcaaggcgtgccgggccatgttcc CRISPR spacer
cagcctcgcgtcaaggcgtgcggggccgtgtcct Protospacer
* * ************** *****.***.*.
89. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP032993 (Escherichia coli strain W5-6 plasmid pMCR_W5-6, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
90. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX518743 (Escherichia coli strain HYEC7 plasmid pHYEC7-IncHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
91. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY401053 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE380 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
92. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
93. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
94. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY019259 (Escherichia coli strain YJMC8 plasmid pHNYJC8, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
95. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY421937 (Escherichia coli strain FS13Z2S plasmid pFS13Z2S, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
96. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
97. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033256 (Salmonella enterica subsp. enterica strain CFSA12 plasmid pCFSA12, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
98. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP026492 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
99. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP034785 (Escherichia coli strain ECZP248 plasmid pTBMCR401, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
100. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
101. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX421096 (Salmonella enterica subsp. enterica serovar Indiana strain A3 plasmid pA3T, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
102. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX434879 (Klebsiella pneumoniae strain KP2442 plasmid pKP2442_1c330, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
103. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KU341381 (Escherichia coli strain SHP45 plasmid pHNSHP45-2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
104. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY019258 (Escherichia coli strain LDHF400 plasmid pHNLDF400, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
105. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX721511 (Salmonella enterica subsp. enterica serovar Typhimurium strain SC523 plasmid pSC523, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
106. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
107. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX084394 (Escherichia coli strain 59 plasmid pECJS-59-244, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
108. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
109. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX246266 (Escherichia coli strain AHCH67 plasmid pHNAH67, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
110. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KX254341 (Escherichia coli strain JS-B60 plasmid pECJS-B60-267, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
111. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
112. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KM396300 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEN110055 plasmid pSEN110055, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
113. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KM396298 (Salmonella enterica subsp. enterica serovar Enteritidis strain KUSR18 plasmid pKUSR18, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
114. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KM396299 (Salmonella enterica subsp. enterica serovar Enteritidis strain SEN112499 plasmid pSEN112499, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
115. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
116. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KT334335 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST06-53 plasmid pHK0653, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
117. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
118. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
119. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
120. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atcgccgttcagaacgtcgtcgccgtcgcca Protospacer
..*.*** *******.***********....
121. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
122. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
123. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP043951 (Escherichia coli strain ST95-32 plasmid pST95-32-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
124. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
125. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP040457 (Salmonella enterica subsp. enterica serovar Typhimurium strain TJWQ005 plasmid pTJWQ005, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
126. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to KY075659 (Escherichia coli strain GD80 plasmid pGD80-2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
127. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
128. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
129. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
130. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
131. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
132. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
133. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to KX023262 (Escherichia coli plasmid pSCE516-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
134. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
135. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
136. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP021727 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
137. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MK574666 (Escherichia coli strain DJB-3 plasmid pDJB-3, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
138. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
139. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN915011 (Escherichia coli strain GD-33 plasmid pNDM33-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
140. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
141. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
142. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN232189 (Escherichia coli plasmid pGD27-124, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
143. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN232191 (Escherichia coli plasmid pGD27-37, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
144. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN232195 (Escherichia coli plasmid pGD27-70, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
145. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
146. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN577015 (Salmonella enterica plasmid p0085-NDM, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
147. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP045844 (Kluyvera intermedia strain HR2 plasmid pHR2-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
148. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN200941 (Escherichia coli strain E648 plasmid pE648CTX-M-65, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
149. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP047379 (Escherichia coli strain CAU16175 plasmid pCAU16175_1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
150. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033382 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
151. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
152. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
153. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP038139 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
154. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
155. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP034820 (Salmonella sp. SSDFZ54 plasmid pTB501, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
156. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
157. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
158. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP012141 (Shigella flexneri 4c strain 1205 plasmid 1205p1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
159. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033385 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
160. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP047877 (Escherichia coli strain LD22-1 plasmid pLD22-1-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
161. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP035918 (Salmonella enterica strain S44712 plasmid pLS44712-MCR, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
162. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to LC511657 (Escherichia coli 2017.02.01CC plasmid p2017.02.01CC DNA, complete genome) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
163. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
164. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
165. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
166. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP021209 (Escherichia coli strain strain Z247 plasmid p2474-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
167. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
168. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP031850 (Klebsiella pneumoniae strain 121 plasmid pKP121-1-mcr, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
169. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
170. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
171. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
172. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP040806 (Escherichia fergusonii strain EFCF056 plasmid pEF01, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
173. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
174. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP030940 (Escherichia coli strain AMSHJX01 plasmid pAMSH1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
175. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP034832 (Salmonella sp. SSDFZ69 plasmid pTB601, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
176. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP036178 (Escherichia coli strain WCHEC025970 plasmid pCTXM199_025970, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
177. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
178. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP022451 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
179. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP019443 (Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
180. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
181. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP024143 (Escherichia coli strain 14EC029 plasmid p14EC029b, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
182. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP047116 (Salmonella enterica subsp. enterica strain SCSM4.1 plasmid plas4.1.1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
183. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
184. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP017294 (Pseudomonas aeruginosa strain PA83 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
aacaacggtcagatcatcgtcgccggcgact Protospacer
. ** ******** *********** *. .
185. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to KX856066 (Salmonella Typhimurium strain HSHLJ1 plasmid pHSHLJ1-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
186. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP041174 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12519v2 plasmid p12519A, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
187. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_LT795115 (Salmonella enterica subsp. enterica serovar Typhimurium isolate VNB151-sc-2315230 plasmid p1) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
188. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
189. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
190. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
191. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
192. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
193. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NC_021845 (Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
194. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP026642 (Escherichia coli strain FORC_082 plasmid pFORC82_1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
195. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP042587 (Escherichia coli strain LD91-1 plasmid pLD91-1-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
196. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
agagatggtcagaacatcgtcacggtcatag Protospacer
. . .***************.* ***** *
197. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
198. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
199. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP043034 (Escherichia coli strain XDL plasmid pXDL-CTX-M-14, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
200. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
201. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MN816370 (Escherichia coli strain A102 plasmid pA102-CTX-M-65, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
202. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033224 (Salmonella enterica subsp. enterica strain CFSA122 plasmid pCFSA122-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
203. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033253 (Salmonella enterica subsp. enterica strain CFSA244 plasmid pCFSA244-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
204. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP047659 (Escherichia coli strain LD39-1 plasmid pLD39-1-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
205. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP047666 (Escherichia coli strain LD26-1 plasmid pLD26-1-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
206. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP047668 (Klebsiella aerogenes strain HNHF1 plasmid pHNHF1_NDM-9, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
207. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
208. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP034390 (Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
209. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to KX856065 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pASSD2-MCR1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
210. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP034788 (Escherichia coli strain ECCNB20-2 plasmid pTBMCR421, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
211. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033636 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb4, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
212. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050778 (Salmonella enterica subsp. enterica serovar Indiana strain SI96 plasmid pSI96-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
213. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
214. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
215. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP033351 (Salmonella enterica subsp. enterica strain CFSA629 plasmid pCFSA629, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
216. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
217. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
218. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
219. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
220. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050751 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
221. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050729 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST106 plasmid pST106-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
222. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050772 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
223. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050761 (Salmonella enterica subsp. enterica serovar Indiana strain SI170 plasmid pSI170-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
224. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
225. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP038454 (Escherichia coli strain EC-129 plasmid pEC129_1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
226. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050754 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
227. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
228. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atcgccggtcagatcgtcgtcgccgtcgcca Protospacer
..*.********* *.***********....
229. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP050763 (Salmonella enterica subsp. enterica serovar Indiana strain SI115 plasmid pSI115-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
230. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
231. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
232. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
233. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
234. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
235. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to MK962305 (Escherichia coli strain YZUC2624 plasmid pYZUC2624.1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
236. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
237. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_LT985297 (Escherichia coli strain B4-25 plasmid RCS77_p, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
238. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
239. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
240. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK355502 (Klebsiella pneumoniae strain CRE plasmid pAN65-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
241. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477605 (Salmonella enterica strain SH15G1428 plasmid pSH15G1428, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
242. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477609 (Salmonella enterica strain SH15G1598 plasmid pSH15G1598, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
243. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477614 (Salmonella enterica strain SH16G1394 plasmid pSH16G1394, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
244. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477619 (Salmonella enterica strain SH16G4918 plasmid pSH16G4918, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
245. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK673548 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDP37-4 plasmid pGDP37-4, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
246. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477606 (Salmonella enterica strain SH15G1450 plasmid pSH15G1450, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
247. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477620 (Salmonella enterica strain SH16G4926 plasmid pSH16G4926, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
248. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK673549 (Salmonella enterica subsp. enterica serovar Typhimurium strain JXP9 plasmid pJXP9, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
249. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477602 (Salmonella enterica strain SH15G1169 plasmid pSH15G1169, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
250. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477607 (Salmonella enterica strain SH15G1452 plasmid pSH15G1452, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
251. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477611 (Salmonella enterica strain SH15G2194 plasmid pSH15G2194, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
252. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477616 (Salmonella enterica strain SH16G2456 plasmid pSH16G2456, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
253. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477603 (Salmonella enterica strain SH15G1219 plasmid pSH15G1219, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
254. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477608 (Salmonella enterica strain SH15G1571 plasmid pSH15G1571, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
255. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477612 (Salmonella enterica strain SH16G0600 plasmid pSH16G0600, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
256. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477617 (Salmonella enterica strain SH16G4466 plasmid pSH16G4466, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
257. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK477618 (Salmonella enterica strain SH16G4511 plasmid pSH16G4511, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
258. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK673547 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDP25-25 plasmid pGDP25-25, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
259. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522426 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G4928 plasmid pSH16G4928, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
260. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
261. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
262. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
263. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
264. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522413 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH14G1670 plasmid pSH14G1670, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
265. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH459020 (Escherichia coli strain GZ6DS2 plasmid pHN6DS2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
266. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH491004 (Escherichia coli strain RJ749 plasmid pRJ749, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
267. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
268. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK293945 (Escherichia coli strain TW4 plasmid pTW4-IncHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
269. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
270. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MF174859 (Escherichia coli strain 6/14/6b plasmid pIncHI2-MU3, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
271. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG014722 (Escherichia coli strain P2-3 plasmid pP2-3T, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
272. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
273. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG014721 (Escherichia coli strain FS11Y5C plasmid pFS11Y5CT, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
274. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG773376 (Escherichia coli strain LSB54 plasmid pLSB54-mcr-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
275. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG825373 (Escherichia coli strain 1106 plasmid p1106-IncHI2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
276. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MF678350 (Escherichia coli strain WCHEC-LL123 plasmid pMCR1_WCHEC-LL123, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
277. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG385063 (Escherichia coli strain WF5-29 plasmid pWF5-29, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
278. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG591702 (Escherichia coli strain EC36 plasmid pMCR-EC36, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
279. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG662415 (Escherichia coli strain EC1107 plasmid EC1107-IncHI2-226K, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
280. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG656414 (Escherichia coli strain 15-50 plasmid pEC15-MCR-50, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
281. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522419 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G1369 plasmid pSH16G1369, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
282. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522418 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G0648 plasmid pSH16G0648, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
283. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH329870 (Escherichia coli strain 92944 plasmid p92944-MCR, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
284. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH128771 (Escherichia coli strain 803DBmcr plasmid 803-DB-mcr, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
285. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522425 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G4909 plasmid pSH16G4909, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
286. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522420 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G1508 plasmid pSH16G1508, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
287. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522421 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G2457 plasmid pSH16G2457, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
288. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH077952 (Escherichia coli strain EC17S-208 plasmid p17S-208, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
289. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522423 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G4498 plasmid pSH16G4498, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
290. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MH522424 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH16G4525 plasmid pSH16G4525, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
291. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
292. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_KY990887 (Escherichia coli strain XG-E1 plasmid pXGE1mcr, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
293. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MF135534 (Raoultella ornithinolytica strain TS48CTX plasmid pHNTS48-1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
294. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_MG372114 (Salmonella enterica subsp. enterica serovar Typhimurium strain JZ26 plasmid pJZ26, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
295. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP022169 (Salmonella enterica subsp. enterica serovar Typhimurium strain WW012 plasmid pWW012, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
296. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP011062 (Escherichia coli str. Sanji plasmid pSJ_255, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
297. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP027202 (Escherichia coli strain WCHEC025943 plasmid pMCR1_025943, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
298. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to KM877269 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDS147 plasmid pHXY0908, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
299. spacer 4.1|3600242|31|NZ_FO538765|CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 9, identity: 0.71
gccaccggtcagaacatcgtcgccgtcattg CRISPR spacer
atggacggtaagaacatcatcgccgtcaatc Protospacer
.. . **** ********.********* *
300. spacer 1.3|2182000|36|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to MG592515 (Vibrio phage 1.144.O._10N.286.45.B3, partial genome) position: , mismatch: 10, identity: 0.722
gagacggtgcgcccggtggtggtggtggcggtgtcg CRISPR spacer
cactatttgcggccggtggtggtggtggtggtggtg Protospacer
* **** ****************.**** .*
301. spacer 1.5|2182134|35|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134444 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.714
gttttgatgcgcaggaacagcaccagcaaagcggc CRISPR spacer
tgcttgaggcgcaggaacagcgccagcaccgaccc Protospacer
.**** *************.****** * *
302. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.697
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
caacgaccatggccgatctgttcgacacggcca Protospacer
.* **********.********* *** .
303. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 10, identity: 0.697
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
cgacgaccatggccgatctgttcgacacggcca Protospacer
.* **********.********* *** .
304. spacer 1.22|2183245|33|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 10, identity: 0.697
gcgcctccatggccgacctgttcgacccggagg CRISPR spacer
caacgaccatggccgatctgttcgacacggcca Protospacer
.* **********.********* *** .
305. spacer 1.33|2183964|35|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.714
catcgcgcccatctcgccattgagcaccagcgttt CRISPR spacer
aaaggacaccgtgtcgccattgagcaccagcgtgc Protospacer
* * **.* ******************** .
306. spacer 1.35|2184096|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017561 (Pseudanabaena sp. ABRG5-3 plasmid ABRG53a, complete sequence) position: , mismatch: 10, identity: 0.706
ctccagggccagtcgctgggaggtctggtcatgg CRISPR spacer
ggtgagggacaggcgctgggaggtctgggaagcg Protospacer
. **** *** *************** * *
307. spacer 1.38|2184291|34|NZ_FO538765|CRT matches to NZ_LR699555 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI) position: , mismatch: 10, identity: 0.706
ctgaaaagcgtcaaggcgtgccgggccatgttcc CRISPR spacer
cggcctgacgtcaaggcgtgcggggccgtgttgt Protospacer
* * ..************* *****.**** .
308. spacer 1.38|2184291|34|NZ_FO538765|CRT matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 10, identity: 0.706
ctgaaaagcgtcaaggcgtgccgggccatgttcc CRISPR spacer
cggccgggcgtcaaggcgtgcggggccgtgtcag Protospacer
* * ..************** *****.***.
309. spacer 1.17|2182919|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 11, identity: 0.676
ccgccccaggtgccgctccagggcatcgaccgaa CRISPR spacer
tccgcccaggtgccgctgccgggcatcgcggtgg Protospacer
.* ************* * ******** ..
310. spacer 1.30|2183769|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 11, identity: 0.676
acaacggtctcgccgttcttgcggacgtggatgg CRISPR spacer
ttggcgatctcgccgttcttgcgggcgttgcgca Protospacer
...**.*****************.*** * .
311. spacer 1.30|2183769|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
acaacggtctcgccgttcttgcggacgtggatgg CRISPR spacer
ttggcgatctcgccgttcttgcgggcgttgcgca Protospacer
...**.*****************.*** * .
312. spacer 1.30|2183769|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 11, identity: 0.676
acaacggtctcgccgttcttgcggacgtggatgg CRISPR spacer
ttggcgatctcgccgttcttgcgggcgttgcgca Protospacer
...**.*****************.*** * .
313. spacer 1.30|2183769|34|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.676
acaacggtctcgccgttcttgcggacgtggatgg CRISPR spacer
ttggcgatctcgccgttcttgcgggcgttgcgca Protospacer
...**.*****************.*** * .
314. spacer 1.34|2184030|35|NZ_FO538765|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134467 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 25, complete sequence) position: , mismatch: 11, identity: 0.686
tccgtaccgccgacggcctgtgcggccctctttac CRISPR spacer
gccgcaccgccgacggcctgcgcggcgacgtggcg Protospacer
***.***************.***** . *
