Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010812 Vibrio cholerae strain 10432-62 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 5 0

Results visualization

1. NZ_CP010812
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010812_1 3671076-3671320 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010812_1 1.1|3671126|39|NZ_CP010812|PILER-CR 3671126-3671164 39 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35466 4 0.897
NZ_CP010812_1 1.1|3671126|39|NZ_CP010812|PILER-CR 3671126-3671164 39 NC_049942 Escherichia phage JLK-2012, complete sequence 23522-23560 5 0.872

1. spacer 1.1|3671126|39|NZ_CP010812|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.897

agtaggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
agtaggtcaccagttcgattccggtagccggcaccaatc	Protospacer
********.***************.*********** *.

2. spacer 1.1|3671126|39|NZ_CP010812|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 5, identity: 0.872

agtaggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
atcaggtcgccagttcgattccggtagccggcaccatat	Protospacer
* .*********************.***********. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 300211 : 311363 15 Vibrio_phage(50.0%) holin NA
DBSCAN-SWA_2 1355281 : 1369994 14 Vibrio_phage(50.0%) terminase NA
DBSCAN-SWA_3 1515990 : 1523183 9 Faustovirus(16.67%) NA NA
DBSCAN-SWA_4 1676902 : 1714350 55 Vibrio_phage(89.36%) transposase,tail,plate,head,protease NA
DBSCAN-SWA_5 3147725 : 3154343 7 Staphylococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage