Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP005969 Pseudomonas syringae pv. syringae B301D chromosome, complete genome 9 crisprs DEDDh,csa3,cas3,DinG 1 0 6 0

Results visualization

1. NZ_CP005969
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_1 438076-438221 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_2 540965-541085 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_3 692409-692502 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_4 1707969-1708105 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_5 2744189-2744433 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_6 4000651-4000761 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_7 4458474-4458575 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_8 5633522-5633630 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005969_9 5680533-5680644 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP005969_8 8.1|5633547|59|NZ_CP005969|CRISPRCasFinder 5633547-5633605 59 NZ_CP005969.1 5633273-5633331 1 0.983

1. spacer 8.1|5633547|59|NZ_CP005969|CRISPRCasFinder matches to position: 5633273-5633331, mismatch: 1, identity: 0.983

ctctgcgtcgcatgcctttctggacgctccgcgtcctcttgacgacgcagagcgtcgaa	CRISPR spacer
ctctgcgtcgtatgcctttctggacgctccgcgtcctcttgacgacgcagagcgtcgaa	Protospacer
**********.************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3244561 : 3309230 85 Pseudomonas_phage(58.49%) tail,integrase,tRNA,terminase,capsid attL 3238355:3238370|attR 3253612:3253627
DBSCAN-SWA_2 3753225 : 3763681 12 uncultured_Caudovirales_phage(75.0%) tRNA NA
DBSCAN-SWA_3 4498523 : 4507431 12 uncultured_Caudovirales_phage(62.5%) NA NA
DBSCAN-SWA_4 5389141 : 5422830 42 Pseudomonas_phage(57.69%) lysis,plate,tail,tRNA NA
DBSCAN-SWA_5 5456004 : 5531633 60 Bacillus_virus(16.67%) holin,integrase,tRNA,transposase attL 5454377:5454398|attR 5497343:5497364
DBSCAN-SWA_6 5740893 : 5828267 99 Pseudomonas_phage(51.22%) lysis,portal,tail,plate,integrase,tRNA,head,terminase,capsid,transposase attL 5785488:5785502|attR 5830213:5830227
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage