Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011478 Spongiibacter sp. IMCC21906 plasmid, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP011477 Spongiibacter sp. IMCC21906, complete genome 2 crisprs cas3,csa3,DinG,DEDDh,RT,PD-DExK 1 0 3 0

Results visualization

1. NZ_CP011477
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011477_1 200219-200347 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011477_2 215517-215841 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP011477_2 2.3|215756|55|NZ_CP011477|PILER-CR 215756-215810 55 NZ_CP011477.1 216125-216179 0 1.0

1. spacer 2.3|215756|55|NZ_CP011477|PILER-CR matches to position: 216125-216179, mismatch: 0, identity: 1.0

tttacctcaagccctgccaaccccttcggcctcggcgcggcctcctacaaaccca	CRISPR spacer
tttacctcaagccctgccaaccccttcggcctcggcgcggcctcctacaaaccca	Protospacer
*******************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1787158 : 1797970 10 Hokovirus(16.67%) tRNA NA
DBSCAN-SWA_2 2018551 : 2028850 6 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_3 2141890 : 2172239 25 uncultured_Mediterranean_phage(20.0%) tail,tRNA,integrase,protease attL 2157530:2157544|attR 2178838:2178852
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage