Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011359 Edwardsiella tarda strain FL95-01 chromosome, complete genome 1 crisprs DEDDh,cas3,csa3,DinG,cas2 1 0 3 0

Results visualization

1. NZ_CP011359
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011359_1 962419-962567 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP011359_1 1.1|962467|53|NZ_CP011359|CRISPRCasFinder 962467-962519 53 NZ_CP011359.1 961742-961794 2 0.962
NZ_CP011359_1 1.1|962467|53|NZ_CP011359|CRISPRCasFinder 962467-962519 53 NZ_CP011359.1 961966-962018 2 0.962

1. spacer 1.1|962467|53|NZ_CP011359|CRISPRCasFinder matches to position: 961742-961794, mismatch: 2, identity: 0.962

gaaggataacatcgcgtagcgatggcccattagggcgaggcatcagccgagtc	CRISPR spacer
gaaggataacatcgcgtagcgatggcccgttagggcgaggcgtcagccgagtc	Protospacer
****************************.************.***********

2. spacer 1.1|962467|53|NZ_CP011359|CRISPRCasFinder matches to position: 961966-962018, mismatch: 2, identity: 0.962

gaaggataacatcgcgtagcgatggcccattagggcgaggcatcagccgagtc	CRISPR spacer
gaaggataacatcgcgtagcgatggcccgttagggcgaggcgtcagccgagtc	Protospacer
****************************.************.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 599424 : 696727 94 Salmonella_phage(19.61%) head,portal,integrase,lysis,tail,terminase,holin,tRNA,capsid,plate attL 632605:632649|attR 662159:662203
DBSCAN-SWA_2 1671552 : 1713580 49 Enterobacteria_phage(38.89%) portal,integrase,tail,terminase,protease,holin attL 1667283:1667297|attR 1689972:1689986
DBSCAN-SWA_3 1884718 : 1894039 11 Brazilian_cedratvirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage