Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011538 Mycoplasma hominis strain Sprott chromosome, complete genome 2 crisprs NA 2 1 2 0

Results visualization

1. NZ_CP011538
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011538_1 114570-114677 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011538_2 270632-270920 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP011538_2 2.2|270720|44|NZ_CP011538|CRT 270720-270763 44 NZ_CP011538.1 270921-270964 0 1.0
NZ_CP011538_2 2.2|270720|44|NZ_CP011538|CRT 270720-270763 44 NZ_CP011538.1 270519-270562 1 0.977
NZ_CP011538_2 2.3|270786|47|NZ_CP011538|CRT 270786-270832 47 NZ_CP011538.1 270450-270496 2 0.957
NZ_CP011538_2 2.3|270786|47|NZ_CP011538|CRT 270786-270832 47 NZ_CP011538.1 270585-270631 2 0.957
NZ_CP011538_2 2.3|270786|47|NZ_CP011538|CRT 270786-270832 47 NZ_CP011538.1 270987-271033 2 0.957
NZ_CP011538_2 2.3|270786|47|NZ_CP011538|CRT 270786-270832 47 NZ_CP011538.1 271122-271168 2 0.957

1. spacer 2.2|270720|44|NZ_CP011538|CRT matches to position: 270921-270964, mismatch: 0, identity: 1.0

ctgtactgggaatagtaatagatttaatgtttgtatctcgaaat	CRISPR spacer
ctgtactgggaatagtaatagatttaatgtttgtatctcgaaat	Protospacer
********************************************

2. spacer 2.2|270720|44|NZ_CP011538|CRT matches to position: 270519-270562, mismatch: 1, identity: 0.977

ctgtactgggaatagtaatagatttaatgtttgtatctcgaaat	CRISPR spacer
ctgtactgggaatagtaatagatttaatgtttgtatcttgaaat	Protospacer
**************************************.*****

3. spacer 2.3|270786|47|NZ_CP011538|CRT matches to position: 270450-270496, mismatch: 2, identity: 0.957

gaccttcgtttaaaattgcttctttaaggtttttgcaaccagaaaac	CRISPR spacer
gaccttcatttaaaattacttctttaaggtttttgcaaccagaaaac	Protospacer
*******.*********.*****************************

4. spacer 2.3|270786|47|NZ_CP011538|CRT matches to position: 270585-270631, mismatch: 2, identity: 0.957

gaccttcgtttaaaattgcttctttaaggtttttgcaaccagaaaac	CRISPR spacer
gaccttcatttaaaattacttctttaaggtttttgcaaccagaaaac	Protospacer
*******.*********.*****************************

5. spacer 2.3|270786|47|NZ_CP011538|CRT matches to position: 270987-271033, mismatch: 2, identity: 0.957

gaccttcgtttaaaattgcttctttaaggtttttgcaaccagaaaac	CRISPR spacer
gaccttcatttaaaattgcttctttaaggtttttacaaccagaaaac	Protospacer
*******.**************************.************

6. spacer 2.3|270786|47|NZ_CP011538|CRT matches to position: 271122-271168, mismatch: 2, identity: 0.957

gaccttcgtttaaaattgcttctttaaggtttttgcaaccagaaaac	CRISPR spacer
gaccttcatttaaaattgcttctttaaggttttcgcaaccagaaaac	Protospacer
*******.*************************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011538_1 1.1|114602|44|NZ_CP011538|CRISPRCasFinder 114602-114645 44 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 664655-664698 0 1.0
NZ_CP011538_1 1.1|114602|44|NZ_CP011538|CRISPRCasFinder 114602-114645 44 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1581498-1581541 12 0.727

1. spacer 1.1|114602|44|NZ_CP011538|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 0, identity: 1.0

cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	CRISPR spacer
cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	Protospacer
********************************************

2. spacer 1.1|114602|44|NZ_CP011538|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 12, identity: 0.727

cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	CRISPR spacer
atctttcttttgcgggtgtagttcaatggtagaacttcagcctt	Protospacer
 *. . *. ******.******************* **** .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 554215 : 562244 6 Mycoplasma_phage(83.33%) tRNA NA
DBSCAN-SWA_2 577552 : 591706 11 Streptococcus_phage(81.82%) integrase attL 572212:572228|attR 598297:598313
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage