Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP012324 Bifidobacterium breve DSM 20213 = JCM 1192 4 crisprs cas3,WYL,c2c9_V-U4 1 1 2 0

Results visualization

1. NZ_AP012324
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP012324_1 1342450-1342563 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP012324_2 2008985-2009131 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP012324_3 2130541-2130625 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP012324_4 2159246-2159322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_AP012324_2 2.1|2009010|36|NZ_AP012324|CRISPRCasFinder 2009010-2009045 36 NZ_AP012324.1 2010347-2010382 1 0.972

1. spacer 2.1|2009010|36|NZ_AP012324|CRISPRCasFinder matches to position: 2010347-2010382, mismatch: 1, identity: 0.972

tcaaagccaatgacagatatttaggaaaccaacccc	CRISPR spacer
tcaaagccaatgacagatatttaggaaatcaacccc	Protospacer
****************************.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP012324_1 1.1|1342477|25|NZ_AP012324|PILER-CR 1342477-1342501 25 NZ_CP017943 Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence 439394-439418 4 0.84

1. spacer 1.1|1342477|25|NZ_AP012324|PILER-CR matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

ggtgcagctctcgcagtgctggagg	CRISPR spacer
tttgcagctctcgacgtgctggagg	Protospacer
  ***********  **********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1482331 : 1494343 15 Propionibacterium_phage(33.33%) head,portal,protease,capsid NA
DBSCAN-SWA_2 1497883 : 1506797 19 Lactococcus_phage(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage