1. spacer 2.8|524639|36|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0
aaaataggaggaaataaattatgactatcaaattaa CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa Protospacer
************************************
2. spacer 2.8|524639|36|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0
aaaataggaggaaataaattatgactatcaaattaa CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa Protospacer
************************************
3. spacer 2.8|524639|36|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0
aaaataggaggaaataaattatgactatcaaattaa CRISPR spacer
aaaataggaggaaataaattatgactatcaaattaa Protospacer
************************************
4. spacer 2.9|524704|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0
tttgttgaatcaacggatatagattttacaatttc CRISPR spacer
tttgttgaatcaacggatatagattttacaatttc Protospacer
***********************************
5. spacer 3.2|2682385|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
agcttgcgtttagaggacgaagaaaaacta CRISPR spacer
agcttgcgtttagaggacgaagaaaaacta Protospacer
******************************
6. spacer 3.6|2682649|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 0, identity: 1.0
taagcgtaatattaatgtcaaagcttctag CRISPR spacer
taagcgtaatattaatgtcaaagcttctag Protospacer
******************************
7. spacer 3.6|2682649|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0
taagcgtaatattaatgtcaaagcttctag CRISPR spacer
taagcgtaatattaatgtcaaagcttctag Protospacer
******************************
8. spacer 3.14|2683178|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 0, identity: 1.0
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
gtgtttctttcccaccttctggttcaacgc Protospacer
******************************
9. spacer 3.15|2683244|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0
gctgcctcgctttactcttcgttatctcca CRISPR spacer
gctgcctcgctttactcttcgttatctcca Protospacer
******************************
10. spacer 3.23|2683772|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttcccatcgatttaaacgcatttaca CRISPR spacer
gcgcttcccatcgatttaaacgcatttaca Protospacer
******************************
11. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
12. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
13. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094025 (Listeria phage LP-032 contig 2, partial genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
14. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
15. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
16. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
17. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
18. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
19. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
20. spacer 3.25|2683904|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 0, identity: 1.0
gccttgcttgacccaactagtgacttcttc CRISPR spacer
gccttgcttgacccaactagtgacttcttc Protospacer
******************************
21. spacer 3.27|2684036|31|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 0, identity: 1.0
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
attcgtgaatgccgacaatcgttcatttcca Protospacer
*******************************
22. spacer 3.29|2684169|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctaggtctagg Protospacer
******************************
23. spacer 3.29|2684169|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctaggtctagg Protospacer
******************************
24. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
25. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
26. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
27. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
28. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gtcatttttaatagtttcaattgctgataa Protospacer
******************************
29. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga Protospacer
******************************
30. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga Protospacer
******************************
31. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacga Protospacer
******************************
32. spacer 3.33|2684169|29|NZ_CP007688|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctaggtctag Protospacer
*****************************
33. spacer 3.33|2684169|29|NZ_CP007688|PILER-CR matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 0, identity: 1.0
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctaggtctag Protospacer
*****************************
34. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MH341452 (Listeria phage PSU-VKH-LP040, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
35. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
36. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
37. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
38. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 0, identity: 1.0
gtcatttttaatagtttcaattgctgata CRISPR spacer
gtcatttttaatagtttcaattgctgata Protospacer
*****************************
39. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg Protospacer
*****************************
40. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to KP399677 (Listeria phage vB_LmoS_188, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg Protospacer
*****************************
41. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 0, identity: 1.0
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tcaaaagcgcgcatgaggaagaaatcacg Protospacer
*****************************
42. spacer 2.3|524318|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971
gcgatttttgtcaaagggacagcgatgggttacaa CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa Protospacer
*****************.*****************
43. spacer 2.7|524575|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NC_021539 (Listeria phage LP-030-2, complete genome) position: , mismatch: 1, identity: 0.971
ctaaaacatccttcactgtatcaactcctttctat CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat Protospacer
******************* ***************
44. spacer 2.7|524575|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.971
ctaaaacatccttcactgtatcaactcctttctat CRISPR spacer
ctaaaacatccttcactgtctcaactcctttctat Protospacer
******************* ***************
45. spacer 2.8|524639|36|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.972
aaaataggaggaaataaattatgactatcaaattaa CRISPR spacer
aaaataggaggaaatagattatgactatcaaattaa Protospacer
****************.*******************
46. spacer 3.2|2682385|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 1, identity: 0.967
agcttgcgtttagaggacgaagaaaaacta CRISPR spacer
agcttgcgtttggaggacgaagaaaaacta Protospacer
***********.******************
47. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_047872 (Listeria phage LMTA-94, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
48. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ591605 (Listeria phage LMTA-57, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
49. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ668717 (Listeria phage LMTA-34 hypothetical proteins, transposase domain-containing protein, and hypothetical proteins genes, complete cds) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttatttagtttgtttatctatctaact Protospacer
*****.************************
50. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ535721 (Listeria phage List-36, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttatccatctaact Protospacer
*********************.********
51. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT668624 (Listeria phage LP-Mix_6.2, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
52. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT178766 (Listeria virus P100plus, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
53. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT178767 (Listeria virus P200, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
54. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ004855 (Listeria bacteriophage P100, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
55. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN128594 (Listeria phage LP-066, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttatttagtttgtttatctatctaact Protospacer
*****.************************
56. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_042048 (Listeria phage LMTA-34, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
57. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_041862 (Listeria phage LP-064, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
58. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094030 (Listeria phage LP-083-2, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttatttagtttgtttatctatctaact Protospacer
*****.************************
59. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JX126918 (Listeria phage LP-125, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
60. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_024360 (Listeria phage LMSP-25, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttgtttagtttgtttacctatctaact Protospacer
*******************.**********
61. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094031 (Listeria phage LP-124, complete genome) position: , mismatch: 1, identity: 0.967
cctttgtttagtttgtttatctatctaact CRISPR spacer
cctttatttagtttgtttatctatctaact Protospacer
*****.************************
62. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_003216 (Listeria phage A118, complete genome) position: , mismatch: 1, identity: 0.967
aacaagaaaaaagatccagacaatattgca CRISPR spacer
aacaagaaaaaagacccagacaatattgca Protospacer
**************.***************
63. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to AJ242593 (Bacteriophage A118 complete genome) position: , mismatch: 1, identity: 0.967
aacaagaaaaaagatccagacaatattgca CRISPR spacer
aacaagaaaaaagacccagacaatattgca Protospacer
**************.***************
64. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ003642 (Listeria phage A006, complete genome) position: , mismatch: 1, identity: 0.967
aacaagaaaaaagatccagacaatattgca CRISPR spacer
aacaagaaaaaagacccagacaatattgca Protospacer
**************.***************
65. spacer 3.5|2682583|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967
gctgttgcaacatgatcaaaaaaattattt CRISPR spacer
gctgtcgcaacatgatcaaaaaaattattt Protospacer
*****.************************
66. spacer 3.6|2682649|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.967
taagcgtaatattaatgtcaaagcttctag CRISPR spacer
taagggtaatattaatgtcaaagcttctag Protospacer
**** *************************
67. spacer 3.14|2683178|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.967
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
gtgtttctttcccaccttccggttcaacgc Protospacer
*******************.**********
68. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094026 (Listeria phage LP-032 contig 3, partial genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
69. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH299806 (Listeria phage LP-KV022, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
70. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN114083 (Listeria phage LP-013, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
71. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_021785 (Listeria phage LP-110, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
72. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN128593 (Listeria phage LP-031, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
73. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_021787 (Listeria phage LP-037, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
74. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN904502 (Listeria phage LP-018, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
75. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JX442241 (Listeria phage P70, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
76. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094020 (Listeria phage LP-026, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
77. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094021 (Listeria phage LP-114, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
78. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN114082 (Listeria phage LP-010, complete genome) position: , mismatch: 1, identity: 0.967
cctttggaggaactgaatttactggcacta CRISPR spacer
catttggaggaactgaatttactggcacta Protospacer
* ****************************
79. spacer 3.27|2684036|31|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 1, identity: 0.968
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
atccgtgaatgccgacaatcgttcatttcca Protospacer
**.****************************
80. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.967
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta Protospacer
**.***************************
81. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta Protospacer
**.***************************
82. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggcgaggtaaatcaatataaagatgcatta Protospacer
**.***************************
83. spacer 3.29|2684169|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.967
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctagatctagg Protospacer
***********************.******
84. spacer 3.29|2684169|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.967
tcgtccactctagtagcatctaggtctagg CRISPR spacer
tcgtccactctagtagcatctagatctagg Protospacer
***********************.******
85. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.966
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
ggcgaggtaaatcaatataaagatgcatt Protospacer
**.**************************
86. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.966
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
ggcgaggtaaatcaatataaagatgcatt Protospacer
**.**************************
87. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to MT500540 (Listeria phage LP-HM00113468, complete genome) position: , mismatch: 1, identity: 0.966
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
ggcgaggtaaatcaatataaagatgcatt Protospacer
**.**************************
88. spacer 3.33|2684169|29|NZ_CP007688|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 1, identity: 0.966
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctagatctag Protospacer
***********************.*****
89. spacer 3.33|2684169|29|NZ_CP007688|PILER-CR matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 1, identity: 0.966
tcgtccactctagtagcatctaggtctag CRISPR spacer
tcgtccactctagtagcatctagatctag Protospacer
***********************.*****
90. spacer 2.3|524318|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943
gcgatttttgtcaaagggacagcgatgggttacaa CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa Protospacer
*****************.**.**************
91. spacer 2.7|524575|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NC_009812 (Listeria phage B025, complete genome) position: , mismatch: 2, identity: 0.943
ctaaaacatccttcactgtatcaactcctttctat CRISPR spacer
ctaaaacatccttcactatctcaactcctttctat Protospacer
*****************.* ***************
92. spacer 3.1|2682319|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ003637 (Listeria phage A500, complete genome) position: , mismatch: 2, identity: 0.933
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttgaagatattaactacattcagaca Protospacer
******.*******.***************
93. spacer 3.1|2682319|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094022 (Listeria phage LP-030-3, complete genome) position: , mismatch: 2, identity: 0.933
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttgaagatattaactacattcagaca Protospacer
******.*******.***************
94. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH341451 (Listeria phage PSU-VKH-LP019, complete genome) position: , mismatch: 2, identity: 0.933
aacaagaaaaaagatccagacaatattgca CRISPR spacer
aacaagaaaaaagatccagacaatgtcgca Protospacer
************************.*.***
95. spacer 3.16|2683310|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 2, identity: 0.933
aacacaccgagcaatagaaatacactgtta CRISPR spacer
agcacaccgagcaatagaaatatactgtta Protospacer
*.********************.*******
96. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JB137888 (Sequence 7 from Patent WO2012159774) position: , mismatch: 2, identity: 0.933
cctttggaggaactgaatttactggcacta CRISPR spacer
catttgggggaactgaatttactggcacta Protospacer
* *****.**********************
97. spacer 3.27|2684036|31|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 2, identity: 0.935
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
atccgtgaatgctgacaatcgttcatttcca Protospacer
**.*********.******************
98. spacer 3.26|2683970|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KJ094027 (Listeria phage LP-083-1 contig 1, partial genome) position: , mismatch: 3, identity: 0.9
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ctattgtcgtcgggtagttcacccatatct Protospacer
.*.*****************.*********
99. spacer 3.26|2683970|30|NZ_CP007688|CRISPRCasFinder,CRT matches to DQ003641 (Listeria phage P35, complete genome) position: , mismatch: 3, identity: 0.9
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ctattgtcgtcgggtagttcacccatatct Protospacer
.*.*****************.*********
100. spacer 2.8|524639|36|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to JN700520 (Staphylococcus phage StB12, complete genome) position: , mismatch: 5, identity: 0.861
aaaataggaggaaataaattatgact-atcaaattaa CRISPR spacer
taaataggaggaagtaaataatgactaatcaaacta- Protospacer
************.***** ****** ******.**
101. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 5, identity: 0.833
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggtggagtaaatcaatataaagatagaata Protospacer
****..******************. * **
102. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 5, identity: 0.833
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggtggagtaaatcaatataaagatagaata Protospacer
****..******************. * **
103. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 5, identity: 0.833
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
ggtggagtaaatcaatataaagatagaata Protospacer
****..******************. * **
104. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to MH319731 (Marine virus AG-345-E02 Ga0172268_11 genomic sequence) position: , mismatch: 5, identity: 0.828
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
ggtggagtaaatcaatataaagatagaat Protospacer
****..******************. * *
105. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 5, identity: 0.828
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
ggtggagtaaatcaatataaagatagaat Protospacer
****..******************. * *
106. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 5, identity: 0.828
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
ggtggagtaaatcaatataaagatagaat Protospacer
****..******************. * *
107. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8
cctttgtttagtttgtttatctatctaact CRISPR spacer
caattgtttagtttgtttatttatttaata Protospacer
* *****************.***.***.
108. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 6, identity: 0.8
cctttgtttagtttgtttatctatctaact CRISPR spacer
caattgtttagtttgtttatttatttaata Protospacer
* *****************.***.***.
109. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8
cctttgtttagtttgtttatctatctaact CRISPR spacer
caattgtttagtttgtttatttatttaata Protospacer
* *****************.***.***.
110. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 6, identity: 0.8
cctttgtttagtttgtttatctatctaact CRISPR spacer
caattgtttagtttgtttatttatttaata Protospacer
* *****************.***.***.
111. spacer 3.5|2682583|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_025830 (Escherichia phage Av-05, complete genome) position: , mismatch: 6, identity: 0.8
-gctgttgcaacatgatcaaaaaaattattt CRISPR spacer
aattgat-caacatgattagaaaaattattt Protospacer
..** * *********.*.***********
112. spacer 3.6|2682649|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP044539 (Borrelia sp. CA690 plasmid cp26, complete sequence) position: , mismatch: 6, identity: 0.8
taagcgtaa--tattaatgtcaaagcttctag CRISPR spacer
--agctacatttattaatgtcaatgcttctag Protospacer
*** * ************ ********
113. spacer 3.7|2682715|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP024448 (Moraxella osloensis strain NP7 plasmid pNP7-5, complete sequence) position: , mismatch: 6, identity: 0.8
tgatggatgacatttctaagcaaataacta CRISPR spacer
tgatgggtaacatttctaagcaaatacggg Protospacer
******.*.***************** .
114. spacer 3.10|2682913|31|NZ_CP007688|CRISPRCasFinder,CRT matches to MW057856 (Providencia phage PSTCR4, complete genome) position: , mismatch: 6, identity: 0.806
ttcagactatgttttcaacaaagggatgcta CRISPR spacer
ttctacctatgttttctacaaaaggatgcaa Protospacer
*** . ********** *****.****** *
115. spacer 3.12|2683046|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 6, identity: 0.8
tcatagtctgttggaacatctgc---atgaact CRISPR spacer
tcatagtctgttggaacatcttccaagtaa--- Protospacer
********************* * .*.*
116. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN694096 (Marine virus AFVG_250M214, complete genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta Protospacer
* .* * **** *****************
117. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN694078 (Marine virus AFVG_250M213, complete genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta Protospacer
* .* * **** *****************
118. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN693931 (Marine virus AFVG_250M215, complete genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
gcaaatgaaaatgaatataaagatgcatta Protospacer
* .* * **** *****************
119. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_029057 (Vibrio phage qdvp001, partial genome) position: , mismatch: 6, identity: 0.8
ggtgaggtaaatcaatataaaga-tgcatta CRISPR spacer
gcagatgtaaatcaatataaagattgtgtt- Protospacer
* ** ***************** **..**
120. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_014660 (Acinetobacter phage Ac42, complete genome) position: , mismatch: 6, identity: 0.8
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcctagttaataattacaattgctgataa Protospacer
** * ******.** *************
121. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_KT897276 (Clostridium botulinum strain INGR16-02E1 plasmid pINGR16-02E1, complete sequence) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
aatgaagtaaatcaatataatgatgaaat Protospacer
..***.************** **** * *
122. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_KT897280 (Clostridium botulinum strain FI1111E1 plasmid pFI1111E1, complete sequence) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
aatgaagtaaatcaatataatgatgaaat Protospacer
..***.************** **** * *
123. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_KT897277 (Clostridium botulinum strain ST0210E1 plasmid pST0210E1, complete sequence) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
aatgaagtaaatcaatataatgatgaaat Protospacer
..***.************** **** * *
124. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_KT897278 (Clostridium botulinum strain FWSKR40E1 plasmid pFWSKR40E1, complete sequence) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
aatgaagtaaatcaatataatgatgaaat Protospacer
..***.************** **** * *
125. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_KT897279 (Clostridium botulinum strain SWKR38E2 plasmid pSWKR38E2, complete sequence) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
aatgaagtaaatcaatataatgatgaaat Protospacer
..***.************** **** * *
126. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to MN694078 (Marine virus AFVG_250M213, complete genome) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
gcaaatgaaaatgaatataaagatgcatt Protospacer
* .* * **** ****************
127. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to MN693931 (Marine virus AFVG_250M215, complete genome) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
gcaaatgaaaatgaatataaagatgcatt Protospacer
* .* * **** ****************
128. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to MN694096 (Marine virus AFVG_250M214, complete genome) position: , mismatch: 6, identity: 0.793
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
gcaaatgaaaatgaatataaagatgcatt Protospacer
* .* * **** ****************
129. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
130. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
131. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
132. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
133. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
134. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
135. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
136. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
137. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
138. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
139. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
140. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
141. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
142. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
143. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
144. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
145. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
146. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
147. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
148. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
149. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
150. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
151. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
152. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
153. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
154. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
155. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
aacttttttaattgtttcaattgctgttt Protospacer
. * ******** ************* *
156. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atcgtttttaatagattcaattgcttctt Protospacer
.**.********** ********** *
157. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
158. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
159. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
160. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
161. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gacatttttaatagtttctaatgcttctt Protospacer
* **************** * **** *
162. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gctttgtttaatattatcaattgctgata Protospacer
*.. * ******* * *************
163. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gctttgtttaatattatcaattgctgata Protospacer
*.. * ******* * *************
164. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ctcatttttgatagtttcagttgcagctt Protospacer
********.*********.**** * *
165. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcatttttaaatgtttcaattgcaccta Protospacer
********** *********** **
166. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
gccattttcaatagcttcaattgctactg Protospacer
*.******.*****.**********. *.
167. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcatttttaaatgtttcaattgcaccta Protospacer
********** *********** **
168. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
atctgttttaatagtttcatttgcttatt Protospacer
.** ************** ***** **
169. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 6, identity: 0.793
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcatttttaaatgtttcaattgcaccta Protospacer
********** *********** **
170. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 6, identity: 0.793
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccg Protospacer
*. .********.************ **
171. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 6, identity: 0.793
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg Protospacer
* ********* *********** * *
172. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 6, identity: 0.793
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctgg Protospacer
* ********* *********** * *
173. spacer 3.1|2682319|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 7, identity: 0.767
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttaaagatatgaacaacataccaatt Protospacer
************** *** **** * .*.
174. spacer 3.1|2682319|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 7, identity: 0.767
caagttaaagatatcaactacattcagaca CRISPR spacer
caagttaaagatatgaacaacataccaatt Protospacer
************** *** **** * .*.
175. spacer 3.5|2682583|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN693453 (Marine virus AFVG_25M364, complete genome) position: , mismatch: 7, identity: 0.767
--gctgttgcaacatgatcaaaaaaattattt CRISPR spacer
caaccat--caacatgctcaataaaattattt Protospacer
.*..* ******* **** **********
176. spacer 3.13|2683112|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134421 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 12) position: , mismatch: 7, identity: 0.767
ttcccagccgtaatagatactaaattacca CRISPR spacer
tcaattgccgaaatagttactaaattacca Protospacer
*. . **** ***** *************
177. spacer 3.14|2683178|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_048855 (Phage NBEco002, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
178. spacer 3.14|2683178|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_017969 (Escherichia phage bV_EcoS_AKFV33, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
179. spacer 3.14|2683178|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_024139 (Escherichia phage vB_EcoS_FFH1, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
180. spacer 3.14|2683178|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN022787 (Salmonella virus VSe12, complete genome) position: , mismatch: 7, identity: 0.767
gtgtttctttcccaccttctggttcaacgc CRISPR spacer
aagtagcttttccagcttctggttcaacga Protospacer
. ** ****.*** **************
181. spacer 3.15|2683244|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT521992 (Rhodococcus phage NiceHouse, complete genome) position: , mismatch: 7, identity: 0.767
gctgcctcgctttactcttcgttatctcca CRISPR spacer
aatacctctctttactcttctttatcttta Protospacer
. *.**** *********** ******..*
182. spacer 3.18|2683442|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 7, identity: 0.767
gaaaaagttgtcgatcttacaaaaaaattc CRISPR spacer
aaaaaagatgtcgatcttaccaaaatctct Protospacer
.****** ************ **** *..
183. spacer 3.24|2683838|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 7, identity: 0.767
cctttggaggaactgaatttactggcacta CRISPR spacer
tcgacgcaggaacagaatttgctggcacta Protospacer
.* .* ****** ******.*********
184. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.767
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
cgttaggtaaatcaatataaaggtttcgta Protospacer
** ******************.* . **
185. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
186. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
187. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR135332 (Enterococcus faecium isolate E7471 plasmid 2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
188. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
189. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
190. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
191. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP038997 (Enterococcus faecium strain SRR24 plasmid pSRR24) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
192. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
193. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
194. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR134107 (Enterococcus faecium isolate E6043 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
195. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP045014 (Enterococcus faecium strain LAC7.2 plasmid pII, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
196. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
197. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP035656 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
198. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
199. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
200. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
201. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP012462 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
202. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
203. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
aacttttttaattgtttcaattgctgtttt Protospacer
. * ******** ************* *
204. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
205. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
206. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
207. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
208. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
tttgggtttaataaattcaattgctgataa Protospacer
*.. *******. ***************
209. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP040742 (Enterococcus faecium strain VRE1 plasmid pVRE1-VanA, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
210. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_AP022343 (Enterococcus faecium strain KUHS13 plasmid pELF2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
211. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
212. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP019994 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
213. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP035662 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atcgtttttaatagattcaattgcttcttg Protospacer
.**.********** ********** * .
214. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_019009 (Staphylococcus aureus plasmid SAP078A, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
215. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP026065 (Staphylococcus aureus strain FDAARGOS_19 plasmid unnamed) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
216. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_014535 (Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gacatttttaatagtttctaatgcttcttt Protospacer
* **************** * **** *
217. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gctttgtttaatattatcaattgctgatag Protospacer
*.. * ******* * *************.
218. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP010104 (Francisella tularensis subsp. novicida strain DPG 3A-IS plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gctttgtttaatattatcaattgctgatag Protospacer
*.. * ******* * *************.
219. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
gccattttcaatagcttcaattgctactgt Protospacer
*.******.*****.**********. *.
220. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcatttttaaatgtttcaattgcacctat Protospacer
********** *********** **
221. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN508817 (Yersinia phage JC221, partial genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
atctgttttaatagtttcatttgcttattc Protospacer
.** ************** ***** **
222. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_018965 (Staphylococcus aureus plasmid SAP077A, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
223. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_013340 (Staphylococcus aureus plasmid SAP076A, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
224. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP028469 (Staphylococcus aureus strain IT1-S plasmid pIT1-S, complete sequence) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ctcatttttgatagtttcagttgcagcttt Protospacer
********.*********.**** * *
225. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcatttttaaatgtttcaattgcacctat Protospacer
********** *********** **
226. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 7, identity: 0.767
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcatttttaaatgtttcaattgcacctat Protospacer
********** *********** **
227. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.767
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
gcgtgagcgcgcacgaggaagaaatcccgc Protospacer
*. .********.************ **
228. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 7, identity: 0.767
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc Protospacer
* ********* *********** * *
229. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 7, identity: 0.767
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
tgcaaagcgcgcttgaggaagaaagctggc Protospacer
* ********* *********** * *
230. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.759
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
cgttaggtaaatcaatataaaggtttcgt Protospacer
** ******************.* . *
231. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_029057 (Vibrio phage qdvp001, partial genome) position: , mismatch: 7, identity: 0.759
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
gcagatgtaaatcaatataaagattgtgt Protospacer
* ** ****************** *
232. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 7, identity: 0.759
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
tccaaagttaatcaatataaagatgcaat Protospacer
..*.** ****************** *
233. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.759
gtcatttttaatagtttcaattgctgata CRISPR spacer
ttcattgttaataatttcaattgctttat Protospacer
***** ******.***********
234. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 7, identity: 0.759
gtcatttttaatagtttcaattgctgata CRISPR spacer
tttgggtttaataaattcaattgctgata Protospacer
*.. *******. **************
235. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 7, identity: 0.759
gtcatttttaatagtttcaattgctgata CRISPR spacer
taaagtttttataatttcaattgctgatt Protospacer
* **** ***.**************
236. spacer 3.35|2684301|29|NZ_CP007688|PILER-CR matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 7, identity: 0.759
tcaaaagcgcgcatgaggaagaaatcacg CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacg Protospacer
.*. .**** ********** *******
237. spacer 2.8|524639|36|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 8, identity: 0.778
aaaataggaggaaataaattatgactatcaaattaa CRISPR spacer
ttaataggaggaaataaataatggctatcgtaagaa Protospacer
***************** ***.*****. * **
238. spacer 3.1|2682319|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.733
caagttaaagatatcaactacattcagaca CRISPR spacer
aaagttaaaggtatcaactacaaggattta Protospacer
*********.*********** * .*
239. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KF771238 (Escherichia phage bV_EcoS_AHS24, complete genome) position: , mismatch: 8, identity: 0.733
cctttgtttagtttgtttatctatctaact CRISPR spacer
tgtttgttttgtttgtttatcgatctcgtc Protospacer
. ******* *********** **** ...
240. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to KF771236 (Escherichia phage bV_EcoS_AHP24, complete genome) position: , mismatch: 8, identity: 0.733
cctttgtttagtttgtttatctatctaact CRISPR spacer
tgtttgttttgtttgtttatcgatctcgtc Protospacer
. ******* *********** **** ...
241. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN693012 (Marine virus AFVG_117M3, complete genome) position: , mismatch: 8, identity: 0.733
cctttgtttagtttgtttatctatctaact CRISPR spacer
tctttgtttagttagtttatttattctttt Protospacer
.************ ******.***.. .*
242. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP017832 (Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence) position: , mismatch: 8, identity: 0.733
cctttgtttagtttgtttatctatctaact CRISPR spacer
tttttgtttagtctgtttatccatccgttt Protospacer
..**********.********.***.. .*
243. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_007581 (Clostridium phage c-st, complete genome) position: , mismatch: 8, identity: 0.733
cctttgtttagtttgtttatctatctaact CRISPR spacer
tctttgtttaatttgtttatctgtaaatag Protospacer
.*********.***********.* *
244. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to AP008983 (Clostridium phage c-st genomic DNA, complete genome) position: , mismatch: 8, identity: 0.733
cctttgtttagtttgtttatctatctaact CRISPR spacer
tctttgtttaatttgtttatctgtaaatag Protospacer
.*********.***********.* *
245. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT932211 (Escherichia phage VEcB, complete genome) position: , mismatch: 8, identity: 0.733
aacaagaaaaaagatccagacaatattgca CRISPR spacer
cagaagaaaaaagatcctgacaataagatc Protospacer
* ************** ******* ..
246. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN850573 (Escherichia phage muut, complete genome) position: , mismatch: 8, identity: 0.733
aacaagaaaaaagatccagacaatattgca CRISPR spacer
cagaagaaaaaagatcctgacaataagatc Protospacer
* ************** ******* ..
247. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN850601 (Escherichia phage inny, complete genome) position: , mismatch: 8, identity: 0.733
aacaagaaaaaagatccagacaatattgca CRISPR spacer
cagaagaaaaaagatcctgacaataagatc Protospacer
* ************** ******* ..
248. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to FR775895 (Enterobacteria phage phi92, complete genome) position: , mismatch: 8, identity: 0.733
aacaagaaaaaagatccagacaatattgca CRISPR spacer
cagaagaaaaaagatcctgacaataagatc Protospacer
* ************** ******* ..
249. spacer 3.4|2682517|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN850632 (Escherichia phage alia, complete genome) position: , mismatch: 8, identity: 0.733
aacaagaaaaaagatccagacaatattgca CRISPR spacer
cagaagaaaaaagatcctgacaataagatc Protospacer
* ************** ******* ..
250. spacer 3.5|2682583|30|NZ_CP007688|CRISPRCasFinder,CRT matches to AP014255 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S25-C160, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
gctgttgcaacatgatcaaaaaaattattt CRISPR spacer
agctcagcaacataatcaaaaaaataattt Protospacer
. . . *******.*********** ****
251. spacer 3.5|2682583|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MT349887 (Acinetobacter phage 5W, complete genome) position: , mismatch: 8, identity: 0.733
gctgttgcaacatgatcaaaaaaattattt CRISPR spacer
gctgttgcaacccgatcaaaaaatcggatg Protospacer
*********** .********** . . *
252. spacer 3.23|2683772|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP013462 (Burkholderia ubonensis strain MSMB1471WGS plasmid pMSMB1471, complete sequence) position: , mismatch: 8, identity: 0.733
gcgcttcccatcgatttaaacgcatttaca CRISPR spacer
gtcgcgtccaacgatttaaacgcatttacc Protospacer
*. . .*** ******************
253. spacer 3.26|2683970|30|NZ_CP007688|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg Protospacer
..*********** .********** *.
254. spacer 3.26|2683970|30|NZ_CP007688|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 8, identity: 0.733
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ccgttgtcgtcggtcagttcgcccagcttg Protospacer
..*********** .********** *.
255. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 8, identity: 0.733
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
aaacatataaatcaatataatgttgcatta Protospacer
.. * .************* * *******
256. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 8, identity: 0.733
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
tccaaagttaatcaatataaagatgcaatg Protospacer
..*.** ****************** *.
257. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
ttcattgttaataatttcaattgctttatg Protospacer
***** ******.*********** .
258. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
259. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
260. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
261. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
262. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
263. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
taaagtttttataatttcaattgctgattt Protospacer
* **** ***.**************
264. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
265. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
266. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.733
gtcatttttaatagtttcaattgctgataa CRISPR spacer
actatttttaatagttgcaattgccataaa Protospacer
...************* *******.. **
267. spacer 3.31|2684301|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP040759 (Paracoccus sp. 2251 plasmid unnamed8, complete sequence) position: , mismatch: 8, identity: 0.733
tcaaaagcgcgcatgaggaagaaatcacga CRISPR spacer
ccgtcggcgcccatgaggaagcaatcacgg Protospacer
.*. .**** ********** *******.
268. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
269. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP035176 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed2) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
270. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP035115 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed2) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
271. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP035567 (Lactobacillus plantarum strain SRCM103300 plasmid unnamed1) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
272. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
273. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
274. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP046661 (Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
275. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
276. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to NZ_CP050809 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP443, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
actatttttaatagttgcaattgccataa Protospacer
...************* *******.. *
277. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
278. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
279. spacer 3.34|2684235|29|NZ_CP007688|PILER-CR matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 8, identity: 0.724
gtcatttttaatagtttcaattgctgata CRISPR spacer
agcatttttaatagcttctattgctctat Protospacer
. ************.*** ******
280. spacer 3.3|2682451|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MN694632 (Marine virus AFVG_250M389, complete genome) position: , mismatch: 9, identity: 0.7
cctttgtttagtttgtttatctatctaact CRISPR spacer
agtttctttagtttgtttatctaatgcaaa Protospacer
*** ***************** . *
281. spacer 3.23|2683772|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MW057858 (Providencia phage PSTCR6, complete genome) position: , mismatch: 9, identity: 0.7
gcgcttcccatcgatttaaacgcatttaca CRISPR spacer
aaatgtcccatcgatttaaacgcaattctc Protospacer
. .. ******************* ** .
282. spacer 3.26|2683970|30|NZ_CP007688|CRISPRCasFinder,CRT matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 9, identity: 0.7
ttgttgtcgtcgggtagttcgcccatatct CRISPR spacer
ggcaggctgtcgggcagttcgcccatatcc Protospacer
*..******.**************.
283. spacer 3.27|2684036|31|NZ_CP007688|CRISPRCasFinder,CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 9, identity: 0.71
attcgtgaatgccgacaatcgttcatttcca CRISPR spacer
aagcgtgaatgccgacaatagtccatcattt Protospacer
* **************** **.***. ..
284. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
285. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
286. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
287. spacer 3.30|2684235|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
gtcatttttaatagtttcaattgctgataa CRISPR spacer
agcatttttaatagcttctattgctctatc Protospacer
. ************.*** ******
288. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
289. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
290. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
291. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
292. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
293. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
294. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
295. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
296. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
297. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
298. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
299. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
300. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
301. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
302. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
303. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
304. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
305. spacer 3.32|2684103|29|NZ_CP007688|PILER-CR matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.69
ggtgaggtaaatcaatataaagatgcatt CRISPR spacer
caaagaaaaaatctatataaagatgcatt Protospacer
. .... ***** ***************
306. spacer 3.19|2683508|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
307. spacer 3.19|2683508|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
308. spacer 3.19|2683508|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
309. spacer 3.19|2683508|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 10, identity: 0.667
accaacggcgcgcaaaagaaaatcattaaa CRISPR spacer
gccaagggcgcgcaaaagaaaaagcggggc Protospacer
.**** **************** ..
310. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
311. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
312. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
313. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
314. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
315. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
316. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
317. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
318. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
319. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP016361 (Bacillus cereus strain M13 plasmid pBCM1301, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
320. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
321. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_011973 (Bacillus cereus Q1 plasmid pBc239, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
322. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
323. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
324. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NC_011777 (Bacillus cereus AH820 plasmid pAH820_272, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
325. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
326. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
327. spacer 3.28|2684103|30|NZ_CP007688|CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667
ggtgaggtaaatcaatataaagatgcatta CRISPR spacer
caaagaaaaaatctatataaagatgcattc Protospacer
. .... ***** ***************
328. spacer 2.9|524704|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 11, identity: 0.686
tttgttgaatcaacggatatagattttacaatttc CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt Protospacer
. .******* ************* ***.*.
329. spacer 2.9|524704|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 11, identity: 0.686
tttgttgaatcaacggatatagattttacaatttc CRISPR spacer
aagaaaaaatcaaccgatatagattttaaaatctt Protospacer
. .******* ************* ***.*.
330. spacer 2.9|524704|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.686
tttgttgaatcaacggatatagattttacaatttc CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt Protospacer
. .******* ************* ***.*.
331. spacer 2.9|524704|35|NZ_CP007688|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.686
tttgttgaatcaacggatatagattttacaatttc CRISPR spacer
agaaaaaaatcaaccgatatagattttaaaatctt Protospacer
. .******* ************* ***.*.