Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 0 crisprs csa3 0 0 0 0
NZ_CP010866 Marinovum algicola DG 898 plasmid pMaD11, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010856 Marinovum algicola DG 898 plasmid pMaD1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010861 Marinovum algicola DG 898 plasmid pMaD6, complete sequence 1 crisprs csa3 0 1 0 0
NZ_CP010855 Marinovum algicola DG 898 chromosome, complete genome 2 crisprs cas3,csa3,cas2,cas1,cas9,WYL,DEDDh 0 17 6 0
NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP010859 Marinovum algicola DG 898 plasmid pMaD4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 0 crisprs WYL 0 0 0 0
NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010864 Marinovum algicola DG 898 plasmid pMaD9, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 0 crisprs NA 0 0 0 0
NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP010861
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010861_1 110186-110274 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010861_1 1.1|110209|43|NZ_CP010861|CRISPRCasFinder 110209-110251 43 NZ_CP010861 Marinovum algicola DG 898 plasmid pMaD6, complete sequence 110209-110251 0 1.0
NZ_CP010861_1 1.1|110209|43|NZ_CP010861|CRISPRCasFinder 110209-110251 43 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 428205-428247 2 0.953

1. spacer 1.1|110209|43|NZ_CP010861|CRISPRCasFinder matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 0, identity: 1.0

cccatcatgccgccacgccgctccaggcccatctcccgctcca	CRISPR spacer
cccatcatgccgccacgccgctccaggcccatctcccgctcca	Protospacer
*******************************************

2. spacer 1.1|110209|43|NZ_CP010861|CRISPRCasFinder matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 2, identity: 0.953

cccatcatgccgccacgccgctccaggcccatctcccgctcca	CRISPR spacer
cccatcatgcctccacgcggctccaggcccatctcccgctcca	Protospacer
*********** ****** ************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010855
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010855_1 1542798-1542896 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010855_2 1702631-1704252 TypeII NA
24 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010855_2 2.2|1702733|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702733-1702762 30 NZ_CP005961 Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence 154567-154596 3 0.9
NZ_CP010855_2 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703526-1703555 30 NZ_CP054603 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed4, complete sequence 57426-57455 4 0.867
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 NZ_CP038238 Leisingera sp. NJS201 plasmid unnamed4, complete sequence 119997-120026 5 0.833
NZ_CP010855_2 2.12|1703395|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703395-1703424 30 NC_047804 Ralstonia phage RS-PII-1, complete genome 39460-39489 5 0.833
NZ_CP010855_2 2.13|1703461|29|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703461-1703489 29 NC_011984 Agrobacterium vitis S4 plasmid pAtS4c, complete sequence 143857-143885 6 0.793
NZ_CP010855_2 2.15|1703592|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703592-1703621 30 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 791509-791538 6 0.8
NZ_CP010855_2 2.15|1703592|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703592-1703621 30 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 964146-964175 6 0.8
NZ_CP010855_2 2.23|1704121|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1704121-1704150 30 CP008938 Candidatus Caedibacter acanthamoebae plasmid Plasmid_00002, complete sequence 31953-31982 6 0.8
NZ_CP010855_2 2.3|1702799|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702799-1702828 30 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 489310-489339 7 0.767
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 196264-196293 7 0.767
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 NZ_CP039694 Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence 136451-136480 7 0.767
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 120664-120693 7 0.767
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 372333-372362 7 0.767
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 AP022674 Sphingomonas sp. HMP9 plasmid pHMP9 DNA, complete sequence 38426-38455 7 0.767
NZ_CP010855_2 2.9|1703196|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703196-1703226 31 MH697589 Microbacterium phage Neferthena, complete genome 39530-39560 7 0.774
NZ_CP010855_2 2.13|1703461|29|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703461-1703489 29 KM389227 UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00003 genomic sequence 5894-5922 7 0.759
NZ_CP010855_2 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703526-1703555 30 MG214783 Sinorhizobium phage HMSP1-Susan, complete genome 6036-6065 7 0.767
NZ_CP010855_2 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703526-1703555 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 258487-258516 7 0.767
NZ_CP010855_2 2.22|1704055|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1704055-1704084 30 KY984068 Erwinia phage vB_EamM_Y3, complete genome 161511-161540 7 0.767
NZ_CP010855_2 2.24|1704187|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1704187-1704216 30 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 259352-259381 7 0.767
NZ_CP010855_2 2.3|1702799|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702799-1702828 30 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 56155-56184 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1398932-1398961 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 MN582054 Microviridae sp. ctYqV29, complete genome 2818-2847 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 KF024728 Mycobacterium phage Muddy, complete genome 12331-12360 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 CP000877 Herpetosiphon aurantiacus DSM 785 plasmid pHAU02, complete sequence 8240-8269 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 MN908690 Microbacterium phage Hubbs, complete genome 24389-24418 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 MN096374 Microbacterium phage Roman, complete genome 24237-24266 8 0.733
NZ_CP010855_2 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702865-1702894 30 MK919474 Microbacterium phage Lupine, complete genome 23591-23620 8 0.733
NZ_CP010855_2 2.6|1702997|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702997-1703026 30 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 110913-110942 8 0.733
NZ_CP010855_2 2.8|1703129|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703129-1703159 31 NC_006552 Pseudomonas phage F116, complete genome 24821-24851 8 0.742
NZ_CP010855_2 2.8|1703129|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703129-1703159 31 AY625898 Pseudomonas aeruginosa phage F116, complete genome 24821-24851 8 0.742
NZ_CP010855_2 2.8|1703129|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703129-1703159 31 LT603684 Pseudomonas phage phiC725A genome assembly 25152-25182 8 0.742
NZ_CP010855_2 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703526-1703555 30 MK376343 Pseudomonas sp. strain ANT_J16 plasmid pA16J1, complete sequence 27752-27781 8 0.733
NZ_CP010855_2 2.16|1703658|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703658-1703687 30 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 479113-479142 8 0.733
NZ_CP010855_2 2.17|1703724|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703724-1703753 30 NC_015969 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence 9976-10005 8 0.733
NZ_CP010855_2 2.22|1704055|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1704055-1704084 30 KT997869 Uncultured Mediterranean phage uvDeep-CGR2-AD3-C76, complete genome 8833-8862 8 0.733
NZ_CP010855_2 2.24|1704187|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1704187-1704216 30 NZ_CP013632 Rhizobium sp. N324 plasmid pRspN324b, complete sequence 360298-360327 8 0.733
NZ_CP010855_2 2.2|1702733|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702733-1702762 30 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 237266-237295 9 0.7
NZ_CP010855_2 2.3|1702799|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1702799-1702828 30 NZ_CP054609 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed1, complete sequence 196558-196587 9 0.7
NZ_CP010855_2 2.12|1703395|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703395-1703424 30 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 760640-760669 9 0.7
NZ_CP010855_2 2.18|1703790|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703790-1703820 31 NZ_CP020970 Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence 5070-5100 9 0.71
NZ_CP010855_2 2.18|1703790|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703790-1703820 31 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 260143-260173 9 0.71
NZ_CP010855_2 2.19|1703857|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1703857-1703886 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 174669-174698 9 0.7
NZ_CP010855_2 2.23|1704121|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder 1704121-1704150 30 MK433266 Streptomyces phage Shawty, complete genome 35961-35990 9 0.7

1. spacer 2.2|1702733|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP005961 (Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.9

gtcggccacccagaccgttacccggtcggt	CRISPR spacer
ggcggccatccagaccgttaccctgtcggt	Protospacer
* ******.************** ******

2. spacer 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054603 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.867

ccgcgcggccatcggatcgagtgcagccag-	CRISPR spacer
ccgcgcggccaccggatcgag-gcggcccgc	Protospacer
***********.********* **.*** * 

3. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038238 (Leisingera sp. NJS201 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
atccagatcggcaaccagggtcagcgtgcg	Protospacer
*** ********.**************  .

4. spacer 2.12|1703395|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_047804 (Ralstonia phage RS-PII-1, complete genome) position: , mismatch: 5, identity: 0.833

cctcgctggctacggcagcgactgcacggt-	CRISPR spacer
cctcgctggctacggcggcgaccac-cagtg	Protospacer
****************.*****..* *.** 

5. spacer 2.13|1703461|29|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_011984 (Agrobacterium vitis S4 plasmid pAtS4c, complete sequence) position: , mismatch: 6, identity: 0.793

tccgcgtttgacgggtcgagaacgggcag	CRISPR spacer
acctcgtttgacgggtctagaacgacaag	Protospacer
 ** ************* ******.  **

6. spacer 2.15|1703592|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.8

gacgtggtgcgcgacatggaaatgcgggtc	CRISPR spacer
gacgtggtgcgcgagatggaaaagacgacc	Protospacer
************** ******* *  *..*

7. spacer 2.15|1703592|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 6, identity: 0.8

gacgtggtgcgcgacatggaaatgcgggtc	CRISPR spacer
gacgtggtgcgcgagatggaaaagacgacc	Protospacer
************** ******* *  *..*

8. spacer 2.23|1704121|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to CP008938 (Candidatus Caedibacter acanthamoebae plasmid Plasmid_00002, complete sequence) position: , mismatch: 6, identity: 0.8

gcacttgccgaggctgaggcgcaactttcc	CRISPR spacer
tctgttgccgaggctgaggagcagctttct	Protospacer
 *  *************** ***.*****.

9. spacer 2.3|1702799|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tactacggacatggccccgacgccgatcac	CRISPR spacer
cagcccgggcatggccccgacgacgatccc	Protospacer
.* . ***.************* ***** *

10. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 7, identity: 0.767

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
cacgagatcggcgcccagcgtcagcggccg	Protospacer
  *********** **** ******* * .

11. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 7, identity: 0.767

atcgagatcggcgaccagggtcagcgtcga-	CRISPR spacer
tccgagatcgccgaccagggtca-tgtagcc	Protospacer
 .******** ************ .** *  

12. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 7, identity: 0.767

atcgagat---cggcgaccagggtcagcgtcga	CRISPR spacer
---gaactgcacgccgaccagggtcagcgtcgg	Protospacer
   **. *   ** ******************.

13. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.767

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
gtcgagatcggcggccagggccagggccag	Protospacer
.************.******.*** *.*..

14. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to AP022674 (Sphingomonas sp. HMP9 plasmid pHMP9 DNA, complete sequence) position: , mismatch: 7, identity: 0.767

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
atcgagatcggctaccaggctcatgggccg	Protospacer
************ ****** ***  * * .

15. spacer 2.9|1703196|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MH697589 (Microbacterium phage Neferthena, complete genome) position: , mismatch: 7, identity: 0.774

---gttcgaaagggacagcttgacgccggagttt	CRISPR spacer
gcagctc---tgggacagcttgacgcctgagctt	Protospacer
   *.**    **************** ***.**

16. spacer 2.13|1703461|29|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to KM389227 (UNVERIFIED: Pseudomonas phage F_MX1987sp/MX560 clone contig00003 genomic sequence) position: , mismatch: 7, identity: 0.759

tccgcgtttgacgggtcgagaacgggcag	CRISPR spacer
agcgcgttggacggatcgagaacggtgcg	Protospacer
  ****** *****.**********   *

17. spacer 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MG214783 (Sinorhizobium phage HMSP1-Susan, complete genome) position: , mismatch: 7, identity: 0.767

ccgcgcggccatcggatcgagtgcagccag	CRISPR spacer
gccttcgtccatcggatcgagtgcagcaaa	Protospacer
 * . ** ******************* *.

18. spacer 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.767

ccgcgcggccatcggatcgagtgcagccag	CRISPR spacer
gcgcgcggccagcagatcgagtgcctcgcg	Protospacer
 ********** *.**********  *  *

19. spacer 2.22|1704055|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to KY984068 (Erwinia phage vB_EamM_Y3, complete genome) position: , mismatch: 7, identity: 0.767

gcgcttgaacagcaaaaagagcatgccagg	CRISPR spacer
ctggctgaacagaaaaaagagaatgccaag	Protospacer
 .* .******* ******** ******.*

20. spacer 2.24|1704187|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

atactcctcttcggagtcgagcatcagcgt	CRISPR spacer
ccgcaccttctcggagtcgagcatcagcgc	Protospacer
 ..* ***..*******************.

21. spacer 2.3|1702799|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 8, identity: 0.733

tactacggacatggccccgacgccgatcac	CRISPR spacer
ggccgcggagatgtccccgacgccgatctg	Protospacer
 .*..**** *** **************  

22. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
gctgccgtcggcggccagggtcagcgccga	Protospacer
...*  .******.************.***

23. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MN582054 (Microviridae sp. ctYqV29, complete genome) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
tgcgagatcggcgacctggctcagccaggt	Protospacer
  ************** ** *****   * 

24. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to KF024728 (Mycobacterium phage Muddy, complete genome) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
agccgcatcggcgaccagagtcagcgtacg	Protospacer
* * . ************.********  .

25. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to CP000877 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU02, complete sequence) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
gcagccatcggcgaccacggccagcgtcgt	Protospacer
.. *  *********** **.******** 

26. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MN908690 (Microbacterium phage Hubbs, complete genome) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
ggcgagatcggcgaccccggtcagcccccg	Protospacer
. **************  ******* .* .

27. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MN096374 (Microbacterium phage Roman, complete genome) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
ggcgagatcggcgaccccggtcagcccccg	Protospacer
. **************  ******* .* .

28. spacer 2.4|1702865|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MK919474 (Microbacterium phage Lupine, complete genome) position: , mismatch: 8, identity: 0.733

atcgagatcggcgaccagggtcagcgtcga	CRISPR spacer
ggcgagatcggcgaccccggtcagcccccg	Protospacer
. **************  ******* .* .

29. spacer 2.6|1702997|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

catgctggggaacctgccacgcgactgcca	CRISPR spacer
taagccggggaacctgccacgcgaagccgg	Protospacer
.* **.******************   * .

30. spacer 2.8|1703129|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_006552 (Pseudomonas phage F116, complete genome) position: , mismatch: 8, identity: 0.742

cttcatcgactattacgaggcagtcgggcag	CRISPR spacer
cttcatcgactactacgaggcacacaacgaa	Protospacer
************.*********  *..  *.

31. spacer 2.8|1703129|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to AY625898 (Pseudomonas aeruginosa phage F116, complete genome) position: , mismatch: 8, identity: 0.742

cttcatcgactattacgaggcagtcgggcag	CRISPR spacer
cttcatcgactactacgaggcacacaacgaa	Protospacer
************.*********  *..  *.

32. spacer 2.8|1703129|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 8, identity: 0.742

cttcatcgactattacgaggcagtcgggcag	CRISPR spacer
cttcatcgactactacgaggcacacaacgaa	Protospacer
************.*********  *..  *.

33. spacer 2.14|1703526|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MK376343 (Pseudomonas sp. strain ANT_J16 plasmid pA16J1, complete sequence) position: , mismatch: 8, identity: 0.733

ccgcgcggccatcggatcgagtgcagccag	CRISPR spacer
tatggtggccatcggatcgagtgcagcaga	Protospacer
.   *.********************* ..

34. spacer 2.16|1703658|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctggactactgcaagcgggctggcgtgat	CRISPR spacer
gtagacctgctgcaagcgggccggcgtgag	Protospacer
 . *. **.************.******* 

35. spacer 2.17|1703724|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_015969 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence) position: , mismatch: 8, identity: 0.733

gtatcgccctcataggtcagggttacagcc	CRISPR spacer
atatcgccgtcataggtcagggcaccggtg	Protospacer
.******* *************.  *.*. 

36. spacer 2.22|1704055|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to KT997869 (Uncultured Mediterranean phage uvDeep-CGR2-AD3-C76, complete genome) position: , mismatch: 8, identity: 0.733

gcgcttgaacagcaaaaagagcatgccagg	CRISPR spacer
gcgctcgaacagcaaaaagagggacagtgg	Protospacer
*****.*************** .     **

37. spacer 2.24|1704187|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 8, identity: 0.733

atactcctcttcggagtcgagcatcagcgt	CRISPR spacer
caccacctcttcggcgtcgagcatccgccc	Protospacer
   * ********* ********** ** .

38. spacer 2.2|1702733|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 9, identity: 0.7

gtcggccacccagaccgttacccggtcggt	CRISPR spacer
gtcggccacccagaccgtgaccaacatacc	Protospacer
****************** *** .  .. .

39. spacer 2.3|1702799|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054609 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

tactacggacatggccccgacgccgatcac	CRISPR spacer
cttataggacatagccccgaagccgatcag	Protospacer
. .   ******.******* ******** 

40. spacer 2.12|1703395|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 9, identity: 0.7

cctcgctggctacggcagcgactgcacggt	CRISPR spacer
cctcgctggcaacggcagcgaccatgtcca	Protospacer
********** ***********.....   

41. spacer 2.18|1703790|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020970 (Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gagctgcgccgactggacgccagcgaggcaa	CRISPR spacer
gtcctgcgccgactggccggcagcgactgtg	Protospacer
*  ************* ** ******    .

42. spacer 2.18|1703790|31|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

gagctgcgccgactggacgccagcgaggcaa	CRISPR spacer
atcgtgcgccggctggacgccatcgagaccc	Protospacer
.   *******.********** ****.*  

43. spacer 2.19|1703857|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.7

cgggtgacaccttgtccagcgcctcatcag	CRISPR spacer
attcatacaccttggccagcgcctcatcgt	Protospacer
      ******** *************. 

44. spacer 2.23|1704121|30|NZ_CP010855|CRT,PILER-CR,CRISPRCasFinder matches to MK433266 (Streptomyces phage Shawty, complete genome) position: , mismatch: 9, identity: 0.7

gcacttgccgaggctgaggcgcaactttcc	CRISPR spacer
gcacttgccgacgctgaggcgaaggcgctg	Protospacer
*********** ********* *. . .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1653896 : 1694165 49 Pandoravirus(13.33%) protease,integrase,terminase,tail,portal attL 1666233:1666251|attR 1682855:1682873
DBSCAN-SWA_2 1710060 : 1761145 55 Corynebacterium_phage(42.86%) integrase,protease,transposase,head attL 1754437:1754482|attR 1766980:1767025
DBSCAN-SWA_3 1874991 : 1885921 11 Streptococcus_phage(25.0%) transposase,terminase NA
DBSCAN-SWA_4 2193837 : 2207712 16 Paracoccus_phage(30.0%) protease,head,tail,capsid,portal NA
DBSCAN-SWA_5 2500280 : 2551545 58 Thiobacimonas_phage(34.21%) protease,transposase,head,tail NA
DBSCAN-SWA_6 2555778 : 2563778 12 Pelagibaca_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010865
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2779 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_2 12057 : 22808 9 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_3 29333 : 30404 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_4 44952 : 49791 4 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage