1. spacer 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 0, identity: 1.0
acggtcgcccgagcgatcaacgagctacagaa CRISPR spacer
acggtcgcccgagcgatcaacgagctacagaa Protospacer
********************************
2. spacer 14.24|2163998|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggtcgcccgagcgatcaacgagctacagaa CRISPR spacer
acggtcgcccgagcgatcaacgagctacagaa Protospacer
********************************
3. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 0, identity: 1.0
cagccagcagcgaatgcgttggcggtcagcat CRISPR spacer
cagccagcagcgaatgcgttggcggtcagcat Protospacer
********************************
4. spacer 14.41|2163997|33|NZ_LN868939|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 0, identity: 1.0
cacggtcgcccgagcgatcaacgagctacagaa CRISPR spacer
cacggtcgcccgagcgatcaacgagctacagaa Protospacer
*********************************
5. spacer 14.41|2163997|33|NZ_LN868939|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
cacggtcgcccgagcgatcaacgagctacagaa CRISPR spacer
cacggtcgcccgagcgatcaacgagctacagaa Protospacer
*********************************
6. spacer 14.51|2164607|33|NZ_LN868939|CRT matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 0, identity: 1.0
ccagccagcagcgaatgcgttggcggtcagcat CRISPR spacer
ccagccagcagcgaatgcgttggcggtcagcat Protospacer
*********************************
7. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
8. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
9. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
10. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
11. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
12. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
13. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
14. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
15. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
16. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
17. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
18. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
19. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
20. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
21. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
22. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
23. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
24. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
25. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
26. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
27. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
******************************
28. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
******************************
29. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
******************************
30. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
******************************
31. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
******************************
32. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga CRISPR spacer
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga Protospacer
******************************************
33. spacer 14.7|2163996|34|NZ_LN868939|PILER-CR matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971
ccacggtcgcccgagcgatcaacgagctacagaa CRISPR spacer
acacggtcgcccgagcgatcaacgagctacagaa Protospacer
*********************************
34. spacer 14.7|2163996|34|NZ_LN868939|PILER-CR matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 1, identity: 0.971
ccacggtcgcccgagcgatcaacgagctacagaa CRISPR spacer
acacggtcgcccgagcgatcaacgagctacagaa Protospacer
*********************************
35. spacer 14.17|2164606|34|NZ_LN868939|PILER-CR matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 1, identity: 0.971
cccagccagcagcgaatgcgttggcggtcagcat CRISPR spacer
accagccagcagcgaatgcgttggcggtcagcat Protospacer
*********************************
36. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
37. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
38. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
*************.****************
39. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
*************.****************
40. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
41. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
42. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
43. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
*************.****************
44. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
*************.****************
45. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
46. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
47. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
48. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
*************.****************
49. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggga Protospacer
*************.****************
50. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
**************************.***
51. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
tggggaccaggtgcgggcccaggtggggga Protospacer
*****************************
52. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
53. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
54. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
55. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
56. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
57. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
58. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
59. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
tggggaccaggtgcgggcccaggtggggga Protospacer
*****************************
60. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
61. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
62. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
63. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
64. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
65. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
66. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggggga Protospacer
*************.****************
67. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.976
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggaggaccaggtggggga Protospacer
**.***************************************
68. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
tggggaccaggtgcgggcccaggtggggga Protospacer
************.****************
69. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
ggaggaccaggtgtgggcccaggtggagga Protospacer
**.***********************.***
70. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga Protospacer
* *** ************************
71. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
tggggaccaggtgcgggcccaggtggggga Protospacer
************.****************
72. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
ggaggaccaggtgtgggcccaggtggagga Protospacer
**.***********************.***
73. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga Protospacer
* *** ************************
74. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
tggggaccaggtgcgggcccaggtggggga Protospacer
************.****************
75. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
ggaggaccaggtgtgggcccaggtggagga Protospacer
**.***********************.***
76. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga Protospacer
* *** ************************
77. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggac Protospacer
****************************.
78. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
*************.************.***
79. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
*************.************.***
80. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
*************.************.***
81. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggac Protospacer
****************************.
82. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
*************.************.***
83. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
*************.************.***
84. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.933
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggagga Protospacer
*************.************.***
85. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.952
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtgggggaccaggtggggga Protospacer
**.***********************.***************
86. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 3, identity: 0.906
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
gcgacgccgaagaaggctcaggtcacgatgcg Protospacer
*. * ***************************
87. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 3, identity: 0.906
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
gccacgccgaagaaggcgcaggtcacgatgcg Protospacer
*.** ************ **************
88. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggac Protospacer
*************.**************.
89. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggac Protospacer
*************.**************.
90. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggtgcgggcccaggtggggac Protospacer
*************.**************.
91. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga Protospacer
* *** *******.****************
92. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.9
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gtgggcccaggtgtgggcccaggtggggga Protospacer
* *** *******.****************
93. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.929
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggaggaccaggtgtgggc Protospacer
**.********************************** ***
94. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
95. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
96. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
97. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
98. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
99. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
100. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
101. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
102. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
103. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
104. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
105. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
106. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
107. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
108. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
109. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
110. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
111. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
112. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
113. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF141540 (Mycobacterium phage Avocado, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
114. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KR080198 (Mycobacterium phage Cambiare, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tccacgccgaagaaggcgcaggtcacgatgcg Protospacer
.** ************ **************
115. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
116. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
117. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tccacgccgaagaaggcgcaggtcacgatgcg Protospacer
.** ************ **************
118. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
119. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
120. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
121. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
122. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
123. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
124. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
125. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
126. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
127. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
128. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
129. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
130. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
131. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
132. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
133. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
134. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
135. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
136. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
137. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
138. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
139. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
140. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
141. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
142. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
143. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 4, identity: 0.875
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacgccgaagaaggcgcaggtcacgatgcg Protospacer
. ** ************ **************
144. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.882
cggcg-agacccacggccgcaccatcggcatcggc CRISPR spacer
-ggtgccgacccacggcctcaccatcggcatcggc Protospacer
**.* *********** ****************
145. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 4, identity: 0.862
gccaaacccaccaccaccaccg-cggcgac CRISPR spacer
accaaacccaccacctccaccgtcggcgg- Protospacer
.************** ****** *****.
146. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 5, identity: 0.844
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg Protospacer
. * ************ **************
147. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX641266 (Mycobacterium phage Terror, complete genome) position: , mismatch: 5, identity: 0.844
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg Protospacer
. * ************ **************
148. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 5, identity: 0.844
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg Protospacer
. * ************ **************
149. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KX641265 (Mycobacterium phage Taheera, complete genome) position: , mismatch: 5, identity: 0.844
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tcgacgccgaagaaggcgcaggtcacgatgcg Protospacer
. * ************ **************
150. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MH779514 (Mycobacterium phage Paito, complete genome) position: , mismatch: 5, identity: 0.844
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcacaccgaagaaggcgcaggtcacgatgcg Protospacer
. ** .*********** **************
151. spacer 6.9|1457380|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844
cgcagggtgttcgtgaacagcgtgtgcgacct CRISPR spacer
cggcgcgtgttcgtgaacagcatgtccgacct Protospacer
** * ***************.*** ******
152. spacer 6.9|1457380|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844
cgcagggtgttcgtgaacagcgtgtgcgacct CRISPR spacer
cggcgcgtgttcgtgaacagcatgtccgacct Protospacer
** * ***************.*** ******
153. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.844
--ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ccggc--gacgaagcgggcgatggccgccgccag Protospacer
*** *.************** ****** ***
154. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844
--ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ctggc--gacgaagcgggcgatggccgccgccag Protospacer
*** *.************** ****** ***
155. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844
--ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ctggc--gacgaagcgggcgatggccgccgccag Protospacer
*** *.************** ****** ***
156. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844
--ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ctggc--gacgaagcgggcgatggccgccgccag Protospacer
*** *.************** ****** ***
157. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.844
--ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ccggc--gacgaagcgggcgatggccgccgccag Protospacer
*** *.************** ****** ***
158. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
159. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
160. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
161. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
162. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
163. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
164. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
165. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
166. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
167. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
168. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
169. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
170. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
171. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
172. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
173. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
174. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
175. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
176. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
177. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
178. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
179. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
180. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
181. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
182. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
183. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
184. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
185. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
186. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
187. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
188. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
189. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
190. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
191. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
192. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
193. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
194. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
195. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
196. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
197. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
198. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
199. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
200. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
201. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
202. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
203. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
204. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
205. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
206. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
207. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
208. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
209. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
210. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
211. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
212. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
213. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
214. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
215. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
216. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcgt Protospacer
* ********** ************ ****
217. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
-gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cgggcgc-agacggaggccgcggtgcggtgggt Protospacer
****** ****** *** ************
218. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 5, identity: 0.844
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
gatcagaccctgcagcgcatcgtcatcgcctg Protospacer
**. ************ ***** ********
219. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.844
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tgccgacccacggcctcaccatcggcatcggc Protospacer
*********** ****************
220. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.848
ggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
gtgccgacccacggcctcaccatcggcatcggc Protospacer
* *********** ****************
221. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 5, identity: 0.828
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
gcccggcccaccaccacgaccgcggcgcc Protospacer
*** ..*********** ********* *
222. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.828
gccaaacccaccaccaccaccgcggcgac- CRISPR spacer
cccatacccaccaccagcaccgc-gcaacg Protospacer
*** *********** ****** **.**
223. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.828
--gccaaacccaccaccaccaccgcggcgac CRISPR spacer
cggcc--gcccaccgccaccaccgcggcggc Protospacer
*** .******.**************.*
224. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.853
ccggtaccgccgccgccacc-cccccgcccccgcc CRISPR spacer
ccgctaccgccgccgccacctccctcgccaccgt- Protospacer
*** **************** ***.**** ***.
225. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.853
ccggtaccgccgccgccacc-cccccgcccccgcc CRISPR spacer
ccgctaccgccgccgccacctccctcgccaccgt- Protospacer
*** **************** ***.**** ***.
226. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.853
ccggtaccgccgccgccacc-cccccgcccccgcc CRISPR spacer
ccgctaccgccgccgccacctccctcgccaccgt- Protospacer
*** **************** ***.**** ***.
227. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.844
cgccaaacccaccaccaccaccgcgg-cgacgc CRISPR spacer
cgccacacccaccgccaccaccgcgaccgatg- Protospacer
***** *******.***********. ***.*
228. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.839
gccaaacccaccaccaccaccgcgg-cgacgc CRISPR spacer
gccacacccaccgccaccaccgcgaccgatg- Protospacer
**** *******.***********. ***.*
229. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.839
gccaaacccaccaccaccaccgcggcgacgc- CRISPR spacer
cccatacccaccaccagcaccgc-gcaacgcg Protospacer
*** *********** ****** **.****
230. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gcaggcccaggtgtgggcccaggtgtgggc Protospacer
* .** ******************* ***
231. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gcaggcccaggtgtgggcccaggtgtgggc Protospacer
* .** ******************* ***
232. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 5, identity: 0.833
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gcaggcccaggtgtgggcccaggtgtgggc Protospacer
* .** ******************* ***
233. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 6, identity: 0.812
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcaccccgaagaagacgcaggtcacgatgcg Protospacer
. ** *********.* **************
234. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KJ410133 (Mycobacterium phage Jolie2, complete genome) position: , mismatch: 6, identity: 0.812
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcactccgaagaagacgcaggtcacgatgcg Protospacer
. ** *********.* **************
235. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 6, identity: 0.812
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
agcaccccgaagaagacgcaggtcacgatgcg Protospacer
. ** *********.* **************
236. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to KR053197 (Gordonia phage GRU3, complete genome) position: , mismatch: 6, identity: 0.812
-gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
tctgctggt-gtcgcggcggggtccggcggcgg Protospacer
*****. *******.*********** ***
237. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.812
gtcga-gggggtgcgggtgcccgcggcgccgcc CRISPR spacer
-tcgatgacggtgcgggtgccggcggcggcgcg Protospacer
**** *. ************ ****** ***
238. spacer 6.11|1457502|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.812
agcaatgttttcacgaccttcgagcaccgcct CRISPR spacer
cacgatgttttctcggccttcgagcaccgccg Protospacer
.*.******** **.***************
239. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.8
acggaggccgccccggtcgggcgcaaatgg CRISPR spacer
ccggaggccgccccggccgggcgcgagatg Protospacer
***************.*******.*. *
240. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.8
acggaggccgccccggtcgggcgcaaatgg CRISPR spacer
tcggacgccgccccggtcggtcgcgcattg Protospacer
**** ************** ***. ** *
241. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019313 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-1, complete sequence) position: , mismatch: 6, identity: 0.812
---ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
gatccgc---gccgtcgccgaggccgaaggactcg Protospacer
**** *** ***************** **
242. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.812
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cggcgctcccttcgccgaggccgaagggctcc Protospacer
* *** *******************. ***
243. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgcgaagccttcgccgaggc--cgaaggaatcc CRISPR spacer
ccgcgaggccttggccgaggccgcgcaggaac-- Protospacer
******.***** ******** ** *****.
244. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgatggtggcgatcctcgtcgccctgaccggc Protospacer
.*** *********** ****** ******
245. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 6, identity: 0.812
---tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
acctgat---ggcgatcctcgacgcccaccccgcc Protospacer
**** ***************** * *** *
246. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 6, identity: 0.812
-gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
ctggaagcc-atcgtcgccggccgcttcacgct Protospacer
.*****. **********.** *********
247. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 6, identity: 0.812
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ccgggggagacggtggtgccggtgcggtggcg Protospacer
* * **********.* *************
248. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.812
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
acgggcgaggcggtggcggcggtgcgg-ggcat Protospacer
. * *****.***************** ***.
249. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gggcgcgagacggtggcggcggtgcggtggcg- CRISPR spacer
gccggcgagacggtcgcggcggtgcgg-ggcat Protospacer
* ********** ************ ***.
250. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.812
---gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gccgggc---agacggtgtcgccggtgcggtggag Protospacer
**** ******** ** *********** *
251. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP037914 (Sphingomonas sp. AAP5 plasmid p213, complete sequence) position: , mismatch: 6, identity: 0.812
gggcgcgagacggtggcggcggtg-cggtggcg CRISPR spacer
aggcgcgagagagtggcggcggtgtcggcggt- Protospacer
.********* .************ ***.**.
252. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
gggcgcgagacggtggcggcggt----gcggtggcg CRISPR spacer
ggtcccgagacggtggcggcggtcgaggcggt---- Protospacer
** * ****************** *****
253. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.824
--ccagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
ggccag--cagctcggcgaccacccgaccaggggcg Protospacer
**** **** *.***************** * *
254. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812
cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
cggcgggtgctggagcgggtgatgaagagccg Protospacer
** .*.*********** ********* ***
255. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.812
ggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtcgg Protospacer
**********.* ************ ** *
256. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtggg Protospacer
**********.* ************ ** *
257. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtcgg Protospacer
**********.* ************ ** *
258. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.812
ggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
ggcggcatcatcggcaccgtcacca---aggtggg Protospacer
**********.* ************ ** *
259. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 6, identity: 0.818
cgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
ggatcagaccctgcagcgcatcgtcatcgcctg Protospacer
**. ************ ***** ********
260. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818
cagcc--cagcgcagcgaccacccgaccaggtggg CRISPR spacer
--gccagcagctcggcgaccacccgaccaggggcg Protospacer
*** **** *.***************** * *
261. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.818
cggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtcgg Protospacer
***********.* ************ ** *
262. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818
cggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtggg Protospacer
***********.* ************ ** *
263. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.818
cggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtcgg Protospacer
***********.* ************ ** *
264. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.818
cggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
cggcggcatcatcggcaccgtcacca---aggtggg Protospacer
***********.* ************ ** *
265. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to KX452697 (UNVERIFIED: Serratia phage KPN4 genomic sequence) position: , mismatch: 6, identity: 0.812
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctg Protospacer
*.* . *************** .*********
266. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to JX878496 (Serratia phage phiMAM1, complete genome) position: , mismatch: 6, identity: 0.812
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctg Protospacer
*.* . *************** .*********
267. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
cccggcggcaccaccaccaccgcggcgac Protospacer
**.. *********************
268. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agtgaacccaccaccaccaccgaggcggc Protospacer
. ..****************** ****.*
269. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
270. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
271. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
272. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
273. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
gccacacccaccgccaccaccgcgaccga Protospacer
**** *******.***********.* .
274. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
275. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
276. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
277. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
agcgacaccaccaccaccacggcggcgac Protospacer
. *.* ************* ********
278. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to MN694695 (Marine virus AFVG_250M866, complete genome) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
accaaaaccaccaccaccaccgccaccag Protospacer
.***** **************** .* *
279. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.793
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ccaaaacgcaccagcaccaccgcggcaat Protospacer
* **** ***** ************.*.
280. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 6, identity: 0.812
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
gtggtgtcgattccacgggcatcggcgtaggc Protospacer
.*. *********.*****.***********
281. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 6, identity: 0.812
ccgaggtcgattccgcgggcgtcggcgtaggc- CRISPR spacer
ccgaggtcgaagccgcgggcgtc-gcgcagcgg Protospacer
********** *********** ***.**
282. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
-tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
gtcaccgg-atgcccgagaagctggccgatgcg Protospacer
**.**.* .****** **** ***********
283. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.812
-tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
gtcaccgg-atgcccgagaagctggccgatgcg Protospacer
**.**.* .****** **** ***********
284. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
-tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
gtcaccgg-atgcccgagaagctggccgatgcg Protospacer
**.**.* .****** **** ***********
285. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.812
gacgtc-gagaaggcgcaggcccaggtcaactt CRISPR spacer
-gcgccggagaacgcgcaggcccaggccaacct Protospacer
.**.* ***** *************.****.*
286. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.806
-gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ggcgcgc-ggcgccgccgtcgttggtgaagat Protospacer
*** .* **************.** *****
287. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.824
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
ccaggcccgccgccgccagcaccccgcccccgac Protospacer
**.* ************ * *********** *
288. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
--cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gacgcc--accgcccaccaccaccgcggcgagga Protospacer
**** *** ****************** *
289. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 6, identity: 0.812
cgccaaacccaccaccaccaccgcggcgacgc- CRISPR spacer
gcccatacccaccaccagcaccgc-gcaacgcg Protospacer
*** *********** ****** **.****
290. spacer 15.45|2278560|34|NZ_LN868939|CRT matches to KX452697 (UNVERIFIED: Serratia phage KPN4 genomic sequence) position: , mismatch: 6, identity: 0.824
gcggtcaggctggtgttgatctcgctgatctggc CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctggc Protospacer
*.* . *************** .***********
291. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 6, identity: 0.806
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cccggcggcaccaccaccaccgcggcgacgc Protospacer
**.. ***********************
292. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 6, identity: 0.806
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cccagggcctccagcaccaccgcggcgacgc Protospacer
***.. ** *** *****************
293. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.806
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gcccggcccaccaccacgaccgcggcgccgg Protospacer
*** ..*********** ********* **
294. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 6, identity: 0.806
--gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cggcc--gcccaccgccaccaccgcggcggcga Protospacer
*** .******.**************.**
295. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 6, identity: 0.806
---gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ggggcca---ccaccgcgaccaccgcggcgacga Protospacer
**** *****.* ***************
296. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 6, identity: 0.806
--gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ctgccga--ccaccaccaccacgggggcgacga Protospacer
***.* ************* * *******
297. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 6, identity: 0.806
---gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ggggcca---ccaccgcgaccaccgcggcgacga Protospacer
**** *****.* ***************
298. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AF311651 (Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds) position: , mismatch: 6, identity: 0.806
gccaaacccaccaccaccaccgcggcgacgc- CRISPR spacer
gccaagcccaccgccaccaccgcctc-ccgct Protospacer
*****.******.********** * ***
299. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gcaggcccaggtgcgggcccaggtgcaggc Protospacer
* .** ******************* .**
300. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
ggtggaccaggtgctggcccaggcgatggc Protospacer
** *********** ********.*. **
301. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc Protospacer
* * * ************ *.********
302. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc Protospacer
* * * ************ *.********
303. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gcaggcccaggtgcgggcccaggtgcaggc Protospacer
* .** ******************* .**
304. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
ggtggaccaggtgctggcccaggcgatggc Protospacer
** *********** ********.*. **
305. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc Protospacer
* * * ************ *.********
306. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.8
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
gcgcgcccaggtgcgggcgcgggtgggggc Protospacer
* * * ************ *.********
307. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 7, identity: 0.781
gggct---ggcggtcgcggtggggtccggcgccgg CRISPR spacer
---ctcgaggcggtcgaggtggggttcggcgcctc Protospacer
** ******** ********.*******
308. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 7, identity: 0.781
gggct---ggcggtcgcggtggggtccggcgccgg CRISPR spacer
---ctcgaggcggtcgaggtggggttcggcgcctc Protospacer
** ******** ********.*******
309. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.774
tgctcgaaggagacgacaaagccgcaatccg CRISPR spacer
gtctcgacggcgacgacaaagccgcagatcg Protospacer
***** ** ***************. .**
310. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.774
tgctcgaaggagacgacaaagccgcaatccg-- CRISPR spacer
cagtcggaggagatgacaaagccgca--ccggc Protospacer
.. ***.******.************ ***
311. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.774
tgctcgaaggagacgacaaagccgcaatccg-- CRISPR spacer
cagtcggaggagatgacaaagccgca--ccggc Protospacer
.. ***.******.************ ***
312. spacer 6.3|1457014|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF621618 (Aeromonas salmonicida subsp. salmonicida strain HER1084 plasmid pAsaXII, complete sequence) position: , mismatch: 7, identity: 0.781
ttgaggctggagcgggaactccggcctcaagg CRISPR spacer
ctgagcctggagcgggaactgcggcgtggtgg Protospacer
.**** ************** **** * . **
313. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
ccgaccacactgctcgacggccttctgagcgg Protospacer
* . ***.************.******** *
314. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
ccgaccacactgctcgacggccttctgagcgg Protospacer
* . ***.************.******** *
315. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
ccgaccacactgctcgacggccttctgagcgg Protospacer
* . ***.************.******** *
316. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
317. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
318. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
319. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
320. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
321. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
322. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
323. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
324. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
325. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.781
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgaaggcattgcgctctg Protospacer
**************** *** ** .* ***
326. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
ctgaccggggtgccggtccccgcggcgccgcc Protospacer
* . ******* *** **************
327. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
acggtgagggtgcgggtgcccgccgccccgcc Protospacer
.. * *.**************** ** *****
328. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MT074151 (Bacteroides phage SJC13, complete genome) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
ggtgagggggtgcgggttcccgtggcgcatgc Protospacer
* .************** ****.***** *
329. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MT074159 (Bacteroides phage SJC23, complete genome) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
ggtgagggggtgcgggttcccgtggcgcatgc Protospacer
* .************** ****.***** *
330. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
gcccagggggtgcgggtgccggcggggcggtg Protospacer
*.* **************** **** ** *.
331. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_HG917973 (Mycobacterium marinum E11 plasmid pRAW, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
gacctgcggctgcgggggcccgcggcgccgca Protospacer
* * * ** ****** **************
332. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018497 (Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
gacctgcggctgcgggggcccgcggcgccgca Protospacer
* * * ** ****** **************
333. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013255 (Kocuria flava strain HO-9041 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggc--gccgcc CRISPR spacer
ctggagggcctgcgggtgcccgcggccaaccg-- Protospacer
* ***** **************** .***
334. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
attgcggtggtgcgggtgcgcgcggcgcaccc Protospacer
.*.* ** *********** ******** **
335. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_006824 (Aromatoleum aromaticum EbN1 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
gtcgagggggtgcgggtgcccgcgg-cgccgcc CRISPR spacer
ggcgacggggtgcgggtggccgcggtcggtga- Protospacer
* *** ************ ****** ** .*
336. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgaagccatcgccgaggccgacgtggtgg Protospacer
********** ************* * ..*
337. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgaagccatcgccgaggccgacgtggtgg Protospacer
********** ************* * ..*
338. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgaagccatcgccgaggcggaccgcaccg Protospacer
********** ********** ** * *.*
339. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgaagcccgcgccgaggccgatgaacacg Protospacer
**********. ************ *.* *
340. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046321 (Gordonia bronchialis strain FDAARGOS_676 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cgcgtcacccccgccgacgtcgacgccgcacg Protospacer
* *.* ******.**** ***********..*
341. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_013442 (Gordonia bronchialis DSM 43247 plasmid pGBRO01, complete sequence) position: , mismatch: 7, identity: 0.781
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cgcgtcacccccgccgacgtcgacgccgcacg Protospacer
* *.* ******.**** ***********..*
342. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gtcgcggccaagcgggcgatgcgcgccgccgg Protospacer
* *. *** ************* ***** *.*
343. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagggcgaagcgggcgatgcccgccgacag- CRISPR spacer
tgcaggacgaagcggtcgatgccc-tcgacgtc Protospacer
*****.******** ******** .****.
344. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gtcgcggccaagcgggcgatgcgcgccgccgg Protospacer
* *. *** ************* ***** *.*
345. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagggcgaagcgggcgatgcccgccgacag- CRISPR spacer
tgcaggacgaagcggtcgatgccc-tcgacgtc Protospacer
*****.******** ******** .****.
346. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gtcgcggccaagcgggcgatgcgcgccgccgg Protospacer
* *. *** ************* ***** *.*
347. spacer 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.781
-tacgagagcaaggggatcggcctggtcctcat CRISPR spacer
atgccag-gcgaggggatcggccgggtcctcga Protospacer
*.* ** **.************ *******.
348. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 7, identity: 0.781
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
gtgccggtgcttaccgaggagcaccccgtcgt Protospacer
* **** **** *************. *.**
349. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 7, identity: 0.781
gagccgct----gctgaccgaggagcacctggccgg CRISPR spacer
----cgcttccggctgaccgacgaggacctggccgc Protospacer
**** ********* *** *********
350. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 7, identity: 0.781
gagccgct----gctgaccgaggagcacctggccgg CRISPR spacer
----cgcttccggctgaccgacgaggacctggccgc Protospacer
**** ********* *** *********
351. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 7, identity: 0.781
gagccgct----gctgaccgaggagcacctggccgg CRISPR spacer
----cgcttccggctgaccgacgaggacctggccgc Protospacer
**** ********* *** *********
352. spacer 12.2|2142501|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.781
tcttcga--cctcccgatcaaaagccctccacca CRISPR spacer
--ctcgacgcctgccgatcaaaagccctcaacgc Protospacer
.**** *** **************** **
353. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
ccgaccgggcgaccctggacgccctcaccgcc Protospacer
. . ********.*** ************* *
354. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 7, identity: 0.781
---tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
ccaagacc---gcgatcctcgccgccctgaccggc Protospacer
**.* ********** ****** ******
355. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tgatccgggagatcctcgccgccggccccacc Protospacer
********* ******** **** * **. *
356. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tgagccgggcgatcctggacgccgttcccaac Protospacer
*** ************ ****** *. **..*
357. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.781
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tgatccgggcggccctcgacgccggtgcccgc Protospacer
***********..********** ..** **
358. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 7, identity: 0.781
cggccacggcgtcgcgtgtggaccggcggctc CRISPR spacer
cgattatggcgtcgcgggtggacgggcggcgc Protospacer
**...*.********* ****** ****** *
359. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT701591 (Burkholderia phage Mana, complete genome) position: , mismatch: 7, identity: 0.781
gagaagctgatcgtcgccgacctcttc-acgct CRISPR spacer
ggcgcgctgatcggcggcgacctcttcaacgc- Protospacer
*. . ******** ** ********** ****
360. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KP966108 (Burkholderia phage vB_BceM_AP3, complete genome) position: , mismatch: 7, identity: 0.781
gagaagctgatcgtcgccgacctcttc-acgct CRISPR spacer
ggcgcgctgatcggcggcgacctcttcaacgc- Protospacer
*. . ******** ** ********** ****
361. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN234192 (Streptomyces phage Animus, complete genome) position: , mismatch: 7, identity: 0.781
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
aacgccaacgccacgctcggcgcgacgtacat Protospacer
..*** ******.************* . ***
362. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MF766047 (Streptomyces phage SqueakyClean, complete genome) position: , mismatch: 7, identity: 0.781
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
aacgccaacgccacgctcggcgcgacgtacat Protospacer
..*** ******.************* . ***
363. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgcgaacgccgcgctcggcgcg-actctcat CRISPR spacer
tgcgcgaacgccgcggtcggcccgtggtctcg- Protospacer
************** ***** ** . ****.
364. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
ggcgcgaacgccgcgctcggcgcga-ctctcat CRISPR spacer
accgcgagcaccgcgctcggcgcgagcccgca- Protospacer
. *****.*.*************** *.* **
365. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH513974 (Gordonia phage LastResort, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
366. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KX557283 (Gordonia phage Remus, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
367. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MF668282 (Gordonia phage ShayRa, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
368. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KX557280 (Gordonia phage JSwag, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
369. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_030698 (Gordonia phage Soups, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
370. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KU998251 (Gordonia phage KatherineG, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
371. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_042123 (Gordonia phage Waits, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
372. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN284898 (Gordonia phage MinecraftSteve, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
373. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_041886 (Gordonia phage Strosahl, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
374. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_030694 (Gordonia phage Rosalind, complete genome) position: , mismatch: 7, identity: 0.781
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtaccgagcctt Protospacer
* *** ************.*******. . **
375. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 7, identity: 0.794
ccgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
tggatcagaccctgcagcgcatcgtcatcgcctg Protospacer
. **. ************ ***** ********
376. spacer 14.9|2164118|34|NZ_LN868939|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794
ccgcaggcgcgagcgcagctcgcgaacgacggcg- CRISPR spacer
ccacaggcgcgcgcgcagctcgcgcgcg-tagcgt Protospacer
**.******** ************ .** ..***
377. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NC_010604 (Mycobacterium marinum M plasmid pMM23, complete sequence) position: , mismatch: 7, identity: 0.794
---cggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
atacgacgaa---cacggccgcatcatcggcagcggc Protospacer
**.***. **********.******** ****
378. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NZ_CP034180 (Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence) position: , mismatch: 7, identity: 0.794
---cggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
atacgacgaa---cacggccgcatcatcggcagcggc Protospacer
**.***. **********.******** ****
379. spacer 14.11|2164240|34|NZ_LN868939|PILER-CR matches to NC_010394 (Mycobacterium abscessus plasmid, complete sequence) position: , mismatch: 7, identity: 0.794
---cggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
atacgacgaa---cacggccgcatcatcggcagcggc Protospacer
**.***. **********.******** ****
380. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ccggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtggg Protospacer
***********.* ************ ** *
381. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.794
ccggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtcgg Protospacer
***********.* ************ ** *
382. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794
ccggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtggg Protospacer
***********.* ************ ** *
383. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794
ccggcggcatcacccgcaccgtcaccatccagct--- CRISPR spacer
gcggcggcatcatcggcaccgtcacca---aggtcgg Protospacer
***********.* ************ ** *
384. spacer 14.14|2164423|34|NZ_LN868939|PILER-CR matches to MT936332 (Streptomyces phage phiRKBJ001, complete genome) position: , mismatch: 7, identity: 0.794
ccccgatgaccgccatcccgccac---ccaagcggac CRISPR spacer
cctcgatggccgccatcccgccacggttccagcg--- Protospacer
**.*****.*************** .* ****
385. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 7, identity: 0.781
----cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
gcctcgcg----cctggaccgcctgatgaagacccg Protospacer
**** ***** ** **************
386. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.781
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
gacacgaccctgcagcgcaccgtgcggacatg Protospacer
***************** *.**** .* **
387. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.781
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
gacacgaccctgcagcgcaccgtgcggacatg Protospacer
***************** *.**** .* **
388. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 7, identity: 0.781
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
gacacgaccctgcagcgcaccgtgcggacatg Protospacer
***************** *.**** .* **
389. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to KX576640 (Arthrobacter phage RcigaStruga, complete genome) position: , mismatch: 7, identity: 0.781
cagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
gagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
390. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MG210949 (Arthrobacter phage Huntingdon, complete genome) position: , mismatch: 7, identity: 0.781
cagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
gagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
391. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MK112529 (Arthrobacter phage BigMack, complete genome) position: , mismatch: 7, identity: 0.781
cagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
gagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
392. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MH179474 (Aeromonas phage 62AhydR11PP, complete genome) position: , mismatch: 7, identity: 0.781
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
caagccccgctcattaccggcgaggaacagta Protospacer
**. * ******** *.************ .*
393. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cgcccagcgcagcgaccaggcgaccagcggca Protospacer
***************** ******* * .
394. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 7, identity: 0.781
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
agcccggcgccgcgaccacccgacgtgcagcg Protospacer
*****.**** ************* * * *
395. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 7, identity: 0.781
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
agcccggcgccgcgaccacccgacgtgcagcg Protospacer
*****.**** ************* * * *
396. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.781
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
ggcttcgaccgggccgacatgatcgccgtcca Protospacer
* ******** ***********.*****. .
397. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 7, identity: 0.781
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgacccggccgacgagaccgccgtcgt Protospacer
*.****************. ********. .
398. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
ccgttcaacccggccggcatgaccgccgtccc Protospacer
* ***.*********.***********. .*
399. spacer 14.27|2164181|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
ccggcgtgcgggaaaaggtgcaggccgtggta CRISPR spacer
ccgaactgctgcaaaaggtgcaggccgtgctg Protospacer
***. *** * ***************** *.
400. spacer 14.27|2164181|32|NZ_LN868939|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781
ccggcgtgcgggaaaaggtgcaggccgtggta CRISPR spacer
ccgaactgctgcaaaaggtgcaggccgtgctg Protospacer
***. *** * ***************** *.
401. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_010604 (Mycobacterium marinum M plasmid pMM23, complete sequence) position: , mismatch: 7, identity: 0.781
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
acgacgaacacggccgcatcatcggcagcggc Protospacer
.*** . **********.******** ****
402. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034180 (Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence) position: , mismatch: 7, identity: 0.781
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
acgacgaacacggccgcatcatcggcagcggc Protospacer
.*** . **********.******** ****
403. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_010394 (Mycobacterium abscessus plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
acgacgaacacggccgcatcatcggcagcggc Protospacer
.*** . **********.******** ****
404. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.781
gcgagacc---cacggccgcaccatcggcatcggc CRISPR spacer
---aggcccagcatggccgcagcatcggcatcggt Protospacer
**.** **.******* ************.
405. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 7, identity: 0.781
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ggcggtaacacccgcaccgtcaccacgccgta Protospacer
*****.* *****************. * *.
406. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ggcggcaacacacgcaccgtcaccacgccgta Protospacer
******* *** *************. * *.
407. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 7, identity: 0.781
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ggcggcatcatccgcaccatcaccgtgacgcg Protospacer
**********.*******.*****.* **
408. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 7, identity: 0.781
cagccagcagcgaatgcgttggcggtcagcat- CRISPR spacer
tcacccgcagcgaatgcgttagcggtta-catg Protospacer
. .** **************.*****.* ***
409. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 7, identity: 0.781
cagccagcagcgaatgcgttggcggtcagcat- CRISPR spacer
tcacccgcagcgaatgcgttagcggtta-catg Protospacer
. .** **************.*****.* ***
410. spacer 14.35|2163631|33|NZ_LN868939|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788
ccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
acggcgggtgctggagcgggtgatgaagagccg Protospacer
** .*.*********** ********* ***
411. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 7, identity: 0.788
cagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cagcccggcgccgcgaccacccgacgtgcagcg Protospacer
******.**** ************* * * *
412. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 7, identity: 0.788
cagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cagcccggcgccgcgaccacccgacgtgcagcg Protospacer
******.**** ************* * * *
413. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788
-cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gcgcc-tcgacccggccgacgtcaccgccgaacg Protospacer
**** **************.* ******* ..
414. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 7, identity: 0.781
-cgaattgggtatcgaaatggtttgccacgtca CRISPR spacer
gcgta-tgggcatcgaaatgggttgccacgggg Protospacer
** * ****.********** ******** .
415. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.781
--gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
tgacgg--aggctggcgctgatctcgctgatgtt Protospacer
.*** *******.*.************* *
416. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
cacgacagcaccaccaccacctcggcgac Protospacer
*.* ************* *******
417. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
acgccaccgcccaccaccaccgcggcgag Protospacer
.* *** ******************
418. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ttctcatgcacgaccaccaccgcggcgac Protospacer
.* *. *** *****************
419. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ttctcatgcacgaccaccaccgcggcgac Protospacer
.* *. *** *****************
420. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ttctcatgcacgaccaccaccgcggcgac Protospacer
.* *. *** *****************
421. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
accgccatcaccaccaccaccgccgcgac Protospacer
.**. .*************** *****
422. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
accgccatcaccaccaccaccgccgcgac Protospacer
.**. .*************** *****
423. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
accccacccaccaccaccaccgccgccgt Protospacer
.** ****************** ** ..
424. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
gggaaacccaccaccaccacctctgccca Protospacer
* ****************** * **
425. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
gggaaacccaccaccaccacctctgccca Protospacer
* ****************** * **
426. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
gggaaacccaccaccaccacctctgccca Protospacer
* ****************** * **
427. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AF311651 (Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds) position: , mismatch: 7, identity: 0.759
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
gccaagcccaccgccaccaccgcctcccg Protospacer
*****.******.********** *
428. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 7, identity: 0.781
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
agtcggaccggttgggcgtcgtcctcgaagag Protospacer
*. *******.***************.**
429. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 7, identity: 0.781
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
ccggggatgggttgggcgtcgtcctcgacgac Protospacer
** **. ***.*************** ***
430. spacer 15.14|2279045|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044987 (Deinococcus sp. AJ005 plasmid p96k, complete sequence) position: , mismatch: 7, identity: 0.781
gggttcacgggctgggcgaccgggaagcggtt CRISPR spacer
ggttgaccgggctgagcgaccgggacgcggtg Protospacer
** * *******.********** *****
431. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
acgccagcgcgcccgagaaggtggcgctggcg Protospacer
********.***** ********* ***
432. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.781
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
gcggtcgagcaggcgcaggcgcaggtcggcgt Protospacer
* ****** ********** ******..* *
433. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to MT310863 (Streptomyces phage Issmi, complete genome) position: , mismatch: 7, identity: 0.781
gacgtcgagaaggcgcaggcccaggtcaactt-- CRISPR spacer
cacgtcgagcaggcgcaggctcagctt--cttgg Protospacer
******** **********.*** *. ***
434. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 7, identity: 0.774
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcg Protospacer
*** ********** ********** *
435. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.774
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcg Protospacer
*** ********** ********** *
436. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.794
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
ccggtaccgccgcggccaccccccgcccggccgc Protospacer
************* ********** ** * *
437. spacer 15.26|2278559|35|NZ_LN868939|PILER-CR matches to KX452697 (UNVERIFIED: Serratia phage KPN4 genomic sequence) position: , mismatch: 7, identity: 0.8
cgcggtcaggctggtgttgatctcgctgatctggc CRISPR spacer
ggtgccaaggctggtgttgatcgtgctgatctggc Protospacer
*.* . *************** .***********
438. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 7, identity: 0.781
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
acccggcggcaccaccaccaccgcggcgacgc Protospacer
**.. ***********************
439. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 7, identity: 0.781
-----cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gaagtcgccg-----accaccaccaccgcgacgacgc Protospacer
****. ***************.******
440. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.781
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gcccagggcctccagcaccaccgcggcgacgc Protospacer
***.. ** *** *****************
441. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 7, identity: 0.781
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tgcccggcccaccaccacgaccgcggcgccgg Protospacer
.*** ..*********** ********* **
442. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 7, identity: 0.781
cgccaaacc---caccaccaccaccgcggcgacgc CRISPR spacer
---ccgaccgggcaccaccacaaccgcggcggcgc Protospacer
* .*** ********* *********.***
443. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 7, identity: 0.781
---cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tggggcca---ccaccgcgaccaccgcggcgacga Protospacer
**** *****.* ***************
444. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781
--cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gctgccga--ccaccaccaccacgggggcgacga Protospacer
.***.* ************* * *******
445. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 7, identity: 0.781
---cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tggggcca---ccaccgcgaccaccgcggcgacga Protospacer
**** *****.* ***************
446. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 7, identity: 0.781
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
caccacgaccagcacgaccaccgcggcgacgg Protospacer
*.*** . *** *** ***************
447. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AF311651 (Bacteriophage GMSE-1 probable tail fiber protein gene, partial cds) position: , mismatch: 7, identity: 0.781
cgccaaacccaccaccaccaccgcggcgacgc- CRISPR spacer
agccaagcccaccgccaccaccgcctc-ccgct Protospacer
*****.******.********** * ***
448. spacer 15.45|2278560|34|NZ_LN868939|CRT matches to JX878496 (Serratia phage phiMAM1, complete genome) position: , mismatch: 7, identity: 0.794
gcggtcaggctggtgttgatctcgctgatctggc CRISPR spacer
gtgccaaggctggtgttgatcgtgctgatctgac Protospacer
*.* . *************** .*********.*
449. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agtgaacccaccaccaccaccgaggcggcga Protospacer
. ..****************** ****.**
450. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
atcaccgccacgaccaccagcgcggcgacgc Protospacer
..** **** ******* ***********
451. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
accgtcgccaccgtcaccaccgcggcgacgc Protospacer
.**. *****..*****************
452. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
453. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
454. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
455. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
456. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
457. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
458. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
459. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcgacaccaccaccaccacggcggcgactc Protospacer
. *.* ************* ******** *
460. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 7, identity: 0.774
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
accacgaccagcacgaccaccgcggcgacgg Protospacer
.*** . *** *** ***************
461. spacer 15.49|2278801|34|NZ_LN868939|CRT matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 7, identity: 0.794
ccgaggtcgattccgcgggcgtcg-gcgtaggcat CRISPR spacer
ccgaggtcgaagccgcgggcgtcgcgcagcggcg- Protospacer
********** ************ **. ***.
462. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788
gcgaacg-ggcgccgccgtcgtcggggaagaggt CRISPR spacer
-cgatcacttcgccgccgtcgtcgggtacgaggt Protospacer
*** *. **************** * *****
463. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggccacacccagagcgaggaagttgcggc CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg Protospacer
*** ********** ********.* * .*
464. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggccacacccagagcgaggaagttgcggc CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg Protospacer
*** ********** ********.* * .*
465. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggccacacccagagcgaggaagttgcggc CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg Protospacer
*** ********** ********.* * .*
466. spacer 5.1|1449368|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggccacacccagagcgaggaagttgcggc CRISPR spacer
ggccgccacacccacagcgaggaggatctgcg Protospacer
*** ********** ********.* * .*
467. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
ctcgtcgcggtagcggtggggtccggcggcgc Protospacer
* ***** **************** **
468. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
gtgccggcggtcgcggcggggtccgtcctcca Protospacer
* **.***********.******** * .* .
469. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 8, identity: 0.75
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
ggtcctctcgtcgcggtggggggcggcgccgg Protospacer
** *. . ************ *********
470. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
tgctcgaaggagacgacaaagccgcaatccg CRISPR spacer
gtctcgtaggagacgacaatgccgcgctcga Protospacer
**** ************ *****. ** .
471. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75
accggcacgctgctcgacggctt---tctgagctg CRISPR spacer
accggcacgctgtccgacggcttctactcgag--- Protospacer
************..********* ...***
472. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MK801721 (Gordonia phage William, complete genome) position: , mismatch: 8, identity: 0.75
accggcacgctgctcgacggctttctgagctg CRISPR spacer
accggcaccctgctcgacgggttcttccgcac Protospacer
******** *********** **..* **
473. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 8, identity: 0.75
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct Protospacer
** . *** *****.*************.*
474. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 8, identity: 0.75
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct Protospacer
** . *** *****.*************.*
475. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_048791 (Corynebacterium phage Adelaide, complete genome) position: , mismatch: 8, identity: 0.75
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct Protospacer
** . *** *****.*************.*
476. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 8, identity: 0.75
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct Protospacer
** . *** *****.*************.*
477. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 8, identity: 0.75
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
acgctcgacgtccccgaccccgacggcgacct Protospacer
** . *** *****.*************.*
478. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
cgccggggggagcgggtggccgcggcgcaggc Protospacer
* .***** ******* ********* * *
479. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
ctgccgacggtgcaggtgcccgaggcgccgcc Protospacer
* *. *****.******** *********
480. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
ggtgcgagggtgcgggtgcgcgccgcgccgga Protospacer
* .* *.************ *** ******
481. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
ctgcgcgaggtgcggctgcccgcggcgctgcc Protospacer
* . *.******* ************.***
482. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagg----gggtgcgggtgcccgcggcgccgcc CRISPR spacer
----aggctgctggcgcgggtgcccgcggcgcggct Protospacer
*** **.***************** **.
483. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
gccgacggggcgcgggtgcccgcgggcgagac Protospacer
*.*** ****.************** * *
484. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagg----gggtgcgggtgcccgcggcgccgcc CRISPR spacer
----aggctgctggcgcgggtgcccgcggcgcggct Protospacer
*** **.***************** **.
485. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 8, identity: 0.75
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
gccgagcgggtgcgggtgccggcgggcgtgct Protospacer
*.**** ************* **** .**.
486. spacer 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder matches to MK479295 (Salmonella phage SEE-1, complete genome) position: , mismatch: 8, identity: 0.758
cccgcaggccgccccgctcacgcgaagaacggc CRISPR spacer
ccaggctgccgccctgctcacgcgcagaacgaa Protospacer
** * *******.********* ******.
487. spacer 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder matches to MT012729 (Salmonella phage vB_SenTO17, complete genome) position: , mismatch: 8, identity: 0.758
cccgcaggccgccccgctcacgcgaagaacggc CRISPR spacer
ccaggctgccgccctgctcacgcgcagaacgaa Protospacer
** * *******.********* ******.
488. spacer 9.1|1887990|33|NZ_LN868939|CRISPRCasFinder matches to MK214385 (Salmonella phage TS6, complete genome) position: , mismatch: 8, identity: 0.758
cccgcaggccgccccgctcacgcgaagaacggc CRISPR spacer
ccaggctgccgccctgctcacgcgcagaacgaa Protospacer
** * *******.********* ******.
489. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cgtcgaagcgctcgccgaggccgaaggagaaa Protospacer
* ****** .*****************.
490. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cgtcgaagcgctcgccgaggccgaaggagaaa Protospacer
* ****** .*****************.
491. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cggcgcagccttcgccgaggacgaagccgttg Protospacer
* *** ************** ***** .*.
492. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cgatgaagcattcgccgcggccgaaggcggcc Protospacer
* ..***** ******* ********* . **
493. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc------ CRISPR spacer
ccgcgaaggcttctccgaggccg------tccacgaca Protospacer
******** **** ********* ***
494. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cgccgatgccttcgccgtggccgaagcgctcg Protospacer
* *** ********** ******** . **
495. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgatgccttcgccgcggccggtgaagccg Protospacer
****** ********** *****. *.*..*
496. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc------ CRISPR spacer
ccgcgaaggcttctccgaggccg------tccacgaca Protospacer
******** **** ********* ***
497. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cgccgatgccttcgccgtggccgaagcgctcg Protospacer
* *** ********** ******** . **
498. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041744 (Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ctacgaagccttcgcagaggacgaagatttac Protospacer
*..************ **** *****. * *
499. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MH590601 (Streptomyces phage Haizum, complete genome) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgagg------ccgaaggaatcc CRISPR spacer
ccgcgaagcctgcgccgaagccggccccgaag------ Protospacer
*********** ******.* ******
500. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK392364 (Streptomyces phage Nishikigoi, complete genome) position: , mismatch: 8, identity: 0.75
ccgcgaagccttcgccgagg------ccgaaggaatcc CRISPR spacer
ccgcgaagcctgcgccgaagccggccccgaag------ Protospacer
*********** ******.* ******
501. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cagatcacccccgccgaggtcgacgccgaact Protospacer
* ** ******.*************** ..
502. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
503. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
504. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
505. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
506. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
507. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015451 (Dietzia lutea strain YIM 80766 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
508. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
509. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
510. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
511. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
512. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015452 (Dietzia lutea strain YIM 80766 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
agcaccgcacccaccggggacgacgccgcgtg Protospacer
**. .* *******.** ************
513. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cgcgtcacccgcaccgaggtcgacggcgcaat Protospacer
* *.* **** ************** ***.
514. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cgcgtcacccgcaccgaggtcgacggcgcaat Protospacer
* *.* **** ************** ***.
515. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
accccgccccccaccgaggtcgccaccgcgcc Protospacer
** .* *************** *.*****.
516. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cgcgtcacccgcaccgaggtcgacggcgcaat Protospacer
* *.* **** ************** ***.
517. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to CP003950 (Rhodococcus opacus PD630 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
aacgtcagcctcaccgaggtcgaggccgcgtt Protospacer
*.* * **.************ *******
518. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
acggtggtgaagcgggcgatgcccgccgcccg Protospacer
. . **.******************** * *
519. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ggcagggcgaagagggcgatgccgatggccga Protospacer
************ ********** .. * *..
520. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
tcctgggcgaagcgggcgatgtcggccgcgat Protospacer
* *****************.* **** *
521. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
tcctgggcgaagcgggcgatgtcggccgcgat Protospacer
* *****************.* **** *
522. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
tgcaggccgtagcgggcgatgcccttggcccg Protospacer
***** ** ************** . * * *
523. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014679 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_5) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ggcagggcgaagagagcgatgccggttgatca Protospacer
************ *.******** *..**. .
524. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
tgcaacctgacgcgggcgatggccgccgacaa Protospacer
***. .** ********** *********.
525. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP039914 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625c, complete sequence) position: , mismatch: 8, identity: 0.75
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
aagccgctgctgatcgtggagcacgaaggccg Protospacer
.************.** ******* .* * *
526. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gagccgct--gctgaccgaggagcacctggccgg CRISPR spacer
--gtcggcgggctgaacgaggagcatctggccgt Protospacer
*.** . ***** *********.*******
527. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 8, identity: 0.75
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
gcccgggagctggccgaggagcacctgaccgt Protospacer
* * * ****.**************.***
528. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134470 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 28, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgcagtgggcgatcctcgtcgcccgcaccgac Protospacer
.* .************ ***** *****.*
529. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
ggtgccgggcgatccacgacgacctcacgcga Protospacer
* *********** ***** ****** *
530. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tgatccgggcgatcgccgacgccaaccgcacc Protospacer
************** .******* * *. *
531. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tgcgcaaggcgatcctcgacgcccacgccgca Protospacer
** * .***************** *.***
532. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgtccgtggcgatcctcgacgcgctcaacgcc Protospacer
.* .* *************** **** ** *
533. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP038031 (Rhodococcus ruber strain R1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
acgtgcgctcgatcctcgacgccggcaccggc Protospacer
.* ** ************** *******
534. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP003958 (Rhodococcus opacus PD630 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
acctcatggcgatcctcgacgcccaccccgcc Protospacer
** ***************** * *** *
535. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
acctcatggcgatcctcgacgcccaccccgcc Protospacer
** ***************** * *** *
536. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75
tgatccg--ggcgatcctcgacgccctcaccggc CRISPR spacer
--gctcgtcggcggtcctcgacgcgctcaccgac Protospacer
...** ****.********** *******.*
537. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cggatcaggcgatccgcgacgcgctcaccgac Protospacer
.*. .*.******** ****** *******.*
538. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 8, identity: 0.75
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cggatcaggcgatccgcgacgcgctcaccgac Protospacer
.*. .*.******** ****** *******.*
539. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 8, identity: 0.75
cggccacggcgtcgcgtgtggaccggcggctc CRISPR spacer
gcgacacggcggcgcgtgtcgaccggcgcttg Protospacer
* ******* ******* ******** .*
540. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
gacgggctgatcggcgccgagctcttcaccgc Protospacer
** ..******** ****** ******** .
541. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN204496 (Streptomyces phage Kardashian, complete genome) position: , mismatch: 8, identity: 0.75
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
ggaaggatgatggttgccgacctcttcacgac Protospacer
*..*.* **** **.*************** .
542. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gggcgcgagacgctggcggcggtcctccccca Protospacer
************ ********** * . *.
543. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ctgcgcgacacggtgacggcggtgcgcacgct Protospacer
****** ******.********** **
544. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gcgatcgtgagggtggcggcggtgcggtcgtc Protospacer
* * ** ** ***************** *.
545. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg Protospacer
*.******* ************ ** .*. .*
546. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN543579 (Klebsiella pneumoniae strain PM48 plasmid pPM48_140, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg Protospacer
*.******* ************ ** .*. .*
547. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN543581 (Klebsiella pneumoniae strain PM48TC plasmid pPM48TC_fusion, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg Protospacer
*.******* ************ ** .*. .*
548. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to LR134207 (Klebsiella aerogenes strain NCTC9667 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg Protospacer
*.******* ************ ** .*. .*
549. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gagcgcgagtcggtggcggcggggccatattg Protospacer
*.******* ************ ** .*. .*
550. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP011044 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gcttgcgagacggtggtggcggggcggggcgg Protospacer
* .************.***** **** * *
551. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021035 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gcttgcgagacggtggtggcggggcggggcgg Protospacer
* .************.***** **** * *
552. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021039 (Clavibacter michiganensis subsp. insidiosus strain ATCC 10253 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gcttgcgagacggtggtggcggggcggggcgg Protospacer
* .************.***** **** * *
553. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
-gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
tgagca-atgacggtggcggaggagcggtggca Protospacer
*.**. . *********** ** ********.
554. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg Protospacer
** * .****.**** *************
555. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg Protospacer
** * .****.**** *************
556. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg Protospacer
** * .****.**** *************
557. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 8, identity: 0.75
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cgggcctcaacggcggcgtcggtgcggtggcg Protospacer
** * .****.**** *************
558. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_017311 (Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
gagaaggtcgccgcgctgggcgcgacgctcat Protospacer
*. . *. ********* ******** *****
559. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_005863 (Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
gagaaggtcgccgcgctgggcgcgacgctcat Protospacer
*. . *. ********* ******** *****
560. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
gagaaggtcgccgcgctgggcgcgacgctcat Protospacer
*. . *. ********* ******** *****
561. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
agcgcgaaggccgcgcccggcgcgctgctgac Protospacer
.******* *******.******* . ** *.
562. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgaacgacgcgctcgacgccatgggcct Protospacer
********** ********.*** *. * *
563. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
tgcgcggacgccgcgctcgccgcgtccgtact Protospacer
*****.************ **** *. * *
564. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
cgcgcaaacggcgcgctcggcgcggcgcgcgg Protospacer
****.**** *************.* * *.
565. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat-- CRISPR spacer
ggcgcgaaggccgcgctcgccgc--cttcgacca Protospacer
******** ********** *** **.. *.
566. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
gctgcgagcgccgcgcccggcgcgaccggcac Protospacer
* .****.********.*********. **.
567. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
cgggcgatcgtcgcgctcggcgcgacggccct Protospacer
* **** **.*************** .* *
568. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75
-ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
cagcg-aaacgccgcgctcggcgagcctctttg Protospacer
.*** .**************** * ****.
569. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021117 (Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
cgggcgatcgtcgcgctcggcgcgacggccct Protospacer
* **** **.*************** .* *
570. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP004396 (Celeribacter indicus strain P73 plasmid pP73C, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
cgggcgatcgtcgcgctcggcgcgacggccct Protospacer
* **** **.*************** .* *
571. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
gtggcgaacgccgcgatcagcgcgaccttctg Protospacer
* ************ **.*******..**
572. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_009956 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence) position: , mismatch: 8, identity: 0.75
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
tcggtcacggtgaccggcccgccccggcggat Protospacer
.*. ****************. ***** * *
573. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT522007 (Gordonia phage Epsocamisio, complete genome) position: , mismatch: 8, identity: 0.75
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtacctagcctt Protospacer
* *** ************.****** . . **
574. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK967382 (Gordonia phage ReMo, complete genome) position: , mismatch: 8, identity: 0.75
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
gggaagacggtgaccggctcgtacctagcctt Protospacer
* *** ************.****** . . **
575. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tccaggccgccgcccgtgatgctgaccgcgcc Protospacer
.** ************.**.********.
576. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
gccagtccgccgccattggtgttgaccgcaag Protospacer
*.** .******** *************. .
577. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcccgccgcccgtggtgttgaccgcgta- CRISPR spacer
ccgctctcgccgcccgtgctgttgacc-cgtgc Protospacer
. **.*********** ******** ***.
578. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
gcgacgccgccgcccgtggtgtcgatcgccca Protospacer
*. *. ****************.**.*** .*
579. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP010871 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
gacaggccgccgccgttggtgttgaccgccag Protospacer
* ** ******** ************* .
580. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
ggcatcccgctgccggtggtgttgatgctgtt Protospacer
* ********.*** **********. .**
581. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.765
cccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
gacggcgggtgctggagcgggtgatgaagagccg Protospacer
** .*.*********** ********* ***
582. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.765
cccgcgagatgctggagcggctga---tgaagacccg CRISPR spacer
cccgcgagatgacggagcggctgagcgtcgcgac--- Protospacer
*********** .*********** * . ***
583. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.765
ccgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
cggacacgaccctgcagcgcaccgtgcggacatg Protospacer
* ***************** *.**** .* **
584. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.765
ccgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
cggacacgaccctgcagcgcaccgtgcggacatg Protospacer
* ***************** *.**** .* **
585. spacer 14.4|2163813|34|NZ_LN868939|PILER-CR matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 8, identity: 0.765
ccgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
cggacacgaccctgcagcgcaccgtgcggacatg Protospacer
* ***************** *.**** .* **
586. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to MN586026 (Gordonia phage Leonard, complete genome) position: , mismatch: 8, identity: 0.765
ccagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
gcagcccggcgccgcgaccacccgacgtgcagcg Protospacer
******.**** ************* * * *
587. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to NC_031112 (Gordonia phage Phinally, complete genome) position: , mismatch: 8, identity: 0.765
ccagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
gcagcccggcgccgcgaccacccgacgtgcagcg Protospacer
******.**** ************* * * *
588. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.765
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ccggcggcatcacccgccgcgtcaccgcggagaa Protospacer
***************** *******.. **
589. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP033221 (Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence) position: , mismatch: 8, identity: 0.765
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ccggcagcatcacccgcaccggcattcatcatct Protospacer
*****.*************** **.. .** **
590. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP033222 (Parasedimentitalea marina strain W43 plasmid pW43C, complete sequence) position: , mismatch: 8, identity: 0.765
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ccggcagcatcacccgcaccggcattcatcatct Protospacer
*****.*************** **.. .** **
591. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgagatgctggagcggctga---tgaagacccg CRISPR spacer
cgagagatgctggagcggctgatcgtgcgagc--- Protospacer
** ******************* ** ...*
592. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
ttccgggccctggagcggctggtgaagacccg Protospacer
. * .*.. ************.**********
593. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_015852 (Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
cgggagaagctggagcggctgattcatgacgg Protospacer
** **** *************** * . * *
594. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgagatgctggagcggctgatgaa--gacccg CRISPR spacer
ggcgagatgctcgaccggctgatgggtcggcc-- Protospacer
********** ** *********.. *.**
595. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
cgcgacatgctggcgcggctgatctacggcgg Protospacer
***** ******* ********* * . * *
596. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgagatgctggagcggctgatgaa--gacccg CRISPR spacer
ggcgagatgctcgaccggctgatgggtcggcc-- Protospacer
********** ** *********.. *.**
597. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
gccacggccctgctgcggatcgtgatgctcca Protospacer
* ****.****** ************ .*..
598. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
gccacggccctgctgcggatcgtgatgctcca Protospacer
* ****.****** ************ .*..
599. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
cacgcgccgctcatgatcggccgggaagccga Protospacer
** ***************** .**** . *
600. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
gggccgctggtcatgatcggcgagg-gcggcac Protospacer
.*****.* *************** .*. **
601. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
ccagcagctcggcgaccacccgaccaggggcg Protospacer
**** *.***************** * *
602. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 8, identity: 0.75
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
ggcccagcgcatcgaccacccggccgagccag Protospacer
.********** **********.**..*. .*
603. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
ctggtcaacccggccgacctgaccgccgagac Protospacer
. **.*********** ********* * *
604. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
ctggtcaacccggccgacctgaccgccgagac Protospacer
. **.*********** ********* * *
605. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
ctggtcaacccggccgacctgaccgccgagac Protospacer
. **.*********** ********* * *
606. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
cccggcgtcccggccgacaagaccgccgccgt Protospacer
** ** *********** ********* .
607. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gatctggtgccggccgacatgatcgccgtgtc Protospacer
* ..* * *************.*****.***
608. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gccttcgacccgtccgacaggacgtaggtgcc Protospacer
************ ****** *** *.*.*
609. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834599 (Microbacterium phage Bernstein, complete genome) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat Protospacer
*.****** ********** ***** * .* .
610. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat Protospacer
*.****** ********** ***** * .* .
611. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat Protospacer
*.****** ********** ***** * .* .
612. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834626 (Microbacterium phage Rollins, complete genome) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat Protospacer
*.****** ********** ***** * .* .
613. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgagccggccgacaagaccggcctgat Protospacer
*.****** ********** ***** * .* .
614. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 8, identity: 0.75
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gtcttcgaaccggccgacaagaccggcctgat Protospacer
*.****** ********** ***** * .* .
615. spacer 14.26|2164120|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcaggcgcgagcgcagctcgcgaacgacggcg CRISPR spacer
cccagcgcgcgcgcagatcgcgaacgaaaccg Protospacer
* .***** ****** ********** . **
616. spacer 14.26|2164120|32|NZ_LN868939|CRISPRCasFinder matches to HM461982 (Burkholderia phage KS14, complete genome) position: , mismatch: 8, identity: 0.75
gcaggcgcgagcgcagctcgcgaacgacggcg CRISPR spacer
aaaggcgcgtgcgcagctcgcgcaccttgtcg Protospacer
. ******* ************ ** .* **
617. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tcacgcactacggccgcaccatcggcgacggc Protospacer
*. * *.*****************. ****
618. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
-----gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tgaccgtga-----acggccgcgccatcggcatccgc Protospacer
*.** ********.*********** **
619. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
-----gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tgaccgtga-----acggccgcgccatcggcatccgc Protospacer
*.** ********.*********** **
620. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
gcatcaaggacgggcgcatcatcggcatcggc Protospacer
**. * **** ****.*************
621. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
gcatccgcgacggccgcatcgtcggcatcggc Protospacer
**. * *********.*.***********
622. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.75
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tcgagaaccacggcctcaccatcgccgtggcg Protospacer
***** ******** ******** *.* *
623. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ggcggcatcacccgccgcgtcaccgcggagaa Protospacer
*************** *******.. **
624. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ggcggcatcacgctcaccgtcaccgacaacgg Protospacer
*********** * **********. * *
625. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ggcggcagcacccgcaccgccacgaccgacgc Protospacer
******* ***********.*** *.* * .
626. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP054600 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
agcggcatcagccgcaccggcaccggctggcg Protospacer
.********* ******** ****. *..**
627. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
gtcgggatcacccgcaccgtcaacactgggcg Protospacer
* *** **************** **.. .**
628. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
gtcgggatcacccgcaccgtcaacactgggcg Protospacer
* *** **************** **.. .**
629. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 8, identity: 0.75
ggcggcatcacccgcaccgtcacc--atccagct CRISPR spacer
cgcgccatcacccgcaccttcaccgaggtcag-- Protospacer
*** ************* ***** . .***
630. spacer 14.31|2164425|32|NZ_LN868939|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 8, identity: 0.75
ccgatgaccgccatcccgccacccaagcggac CRISPR spacer
tcgatgaccgacaacccgccacccgtgcacaa Protospacer
.********* ** **********. **. *
631. spacer 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 8, identity: 0.75
cggtcctcacccgtgtcgggcccg----cggtactg CRISPR spacer
cggtcctcacccgtgacgggaccgttgacgac---- Protospacer
*************** **** *** **..
632. spacer 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.75
cggtcctcacccgtgtcgggcccg----cggtactg CRISPR spacer
cggtcctcacccgtgacggggccgttgacgac---- Protospacer
*************** **** *** **..
633. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
acgaacagcagcgtcctgaggtcgagcgcgag Protospacer
*****.********* ******* * **.
634. spacer 14.34|2164608|32|NZ_LN868939|CRISPRCasFinder matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 8, identity: 0.75
cagccagcagcgaatgcgttggcggtcagcat CRISPR spacer
aagccagcaacgaatgcgatggcggtggttgt Protospacer
********.******** ******* . ..*
635. spacer 14.35|2163631|33|NZ_LN868939|CRT matches to NC_015852 (Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence) position: , mismatch: 8, identity: 0.758
ccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
ccgggagaagctggagcggctgattcatgacgg Protospacer
*** **** *************** * . * *
636. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.758
cgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
ggacacgaccctgcagcgcaccgtgcggacatg Protospacer
***************** *.**** .* **
637. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 8, identity: 0.758
cgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
ggacacgaccctgcagcgcaccgtgcggacatg Protospacer
***************** *.**** .* **
638. spacer 14.38|2163814|33|NZ_LN868939|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.758
cgacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
ggacacgaccctgcagcgcaccgtgcggacatg Protospacer
***************** *.**** .* **
639. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to KX576640 (Arthrobacter phage RcigaStruga, complete genome) position: , mismatch: 8, identity: 0.758
ccagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
ggagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
640. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MG210949 (Arthrobacter phage Huntingdon, complete genome) position: , mismatch: 8, identity: 0.758
ccagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
ggagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
641. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MK112529 (Arthrobacter phage BigMack, complete genome) position: , mismatch: 8, identity: 0.758
ccagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
ggagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
642. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
cagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
tcgcccagcgcagcgaccaggcgaccagcggca Protospacer
. ***************** ******* * .
643. spacer 14.40|2163936|33|NZ_LN868939|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 8, identity: 0.758
cagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cggcccagcgcatcgaccacccggccgagccag Protospacer
*.********** **********.**..*. .*
644. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.758
cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gccgttcaacccggccggcatgaccgccgtccc Protospacer
* ***.*********.***********. .*
645. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
cgccttcgacccgtccgacaggacgtaggtgcc Protospacer
************* ****** *** *.*.*
646. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.758
cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
cctggtcaacccggccgacctgaccgccgagac Protospacer
* . **.*********** ********* * *
647. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 8, identity: 0.758
cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
cctggtcaacccggccgacctgaccgccgagac Protospacer
* . **.*********** ********* * *
648. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 8, identity: 0.758
cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
cctggtcaacccggccgacctgaccgccgagac Protospacer
* . **.*********** ********* * *
649. spacer 14.42|2164058|33|NZ_LN868939|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 8, identity: 0.758
cgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
ccccggcgtcccggccgacaagaccgccgccgt Protospacer
* ** ** *********** ********* .
650. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NZ_CP034180 (Mycobacteroides abscessus strain GZ002 plasmid pMabS_GZ002, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tacgacgaacacggccgcatcatcggcagcggc Protospacer
.*** . **********.******** ****
651. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NC_010394 (Mycobacterium abscessus plasmid, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tacgacgaacacggccgcatcatcggcagcggc Protospacer
.*** . **********.******** ****
652. spacer 14.45|2164241|33|NZ_LN868939|CRT matches to NC_010604 (Mycobacterium marinum M plasmid pMM23, complete sequence) position: , mismatch: 8, identity: 0.758
ggcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tacgacgaacacggccgcatcatcggcagcggc Protospacer
.*** . **********.******** ****
653. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758
cggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
cggcggcatcacccgccgcgtcaccgcggagaa Protospacer
**************** *******.. **
654. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 8, identity: 0.758
cggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
gggcggtaacacccgcaccgtcaccacgccgta Protospacer
*****.* *****************. * *.
655. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
cggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
gggcggcaacacacgcaccgtcaccacgccgta Protospacer
******* *** *************. * *.
656. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 8, identity: 0.758
cggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
cggcggcagcacccgcaccgccacgaccgacgc Protospacer
******** ***********.*** *.* * .
657. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 8, identity: 0.758
cggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
tggcggcatcatccgcaccatcaccgtgacgcg Protospacer
.**********.*******.*****.* **
658. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 8, identity: 0.75
gcatggaccccggccacatgcgcg-----gcttcata CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct----- Protospacer
** *************** **** ***
659. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75
gcatggaccccggccacatgcgcg-----gcttcata CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct----- Protospacer
** *************** **** ***
660. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75
gcatggaccccggccacatgcgcg-----gcttcata CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct----- Protospacer
** *************** **** ***
661. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75
gcatggaccccggccacatgcgcg-----gcttcata CRISPR spacer
ccaaggaccccggccacatccgcgcaaacgct----- Protospacer
** *************** **** ***
662. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgaattggg-tatcgaaatggtttgccacgtca CRISPR spacer
-gaacgaggctatcgaaatggttcgccacgatc Protospacer
***. .** *************.****** .
663. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
tggcgcaggctggcgctgatctcgctgatgtt Protospacer
* ********.*.************* *
664. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.75
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
gcggtcagtgtggtgttgatctccggcatcgc Protospacer
******** ************* ***
665. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ctgtttgccaccaccaccaccgccgcgac Protospacer
. **************** *****
666. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
aatccacccagcagcaccaccgcggcgat Protospacer
. . ***** ** **************.
667. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026696 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
accaatcccaccaccaccgccgcgattgg Protospacer
.**** ************.*****.. .
668. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ttctcgtgcacgaccaccaccgcggcgac Protospacer
.* .. *** *****************
669. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ttctcgtgcacgaccaccaccgcggcgac Protospacer
.* .. *** *****************
670. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
ttaccccccaccaacaccaccgcgtcgac Protospacer
. ******* ********** ****
671. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
aagtcgccgaccaccaccaccgcgacgac Protospacer
. .** ***************.****
672. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to KT997874 (Uncultured Mediterranean phage uvDeep-CGR2-KM23-C198, complete genome) position: , mismatch: 8, identity: 0.724
gccaaacccaccaccaccaccgcggcgac CRISPR spacer
catagacccaccaccaccgccgcggccca Protospacer
.*.*************.*******
673. spacer 15.9|2278740|32|NZ_LN868939|CRISPRCasFinder matches to MH316566 (Gordonia phage Nedarya, complete genome) position: , mismatch: 8, identity: 0.75
gccgactccttggactcgacgtagttcttcag CRISPR spacer
cccgcgaccttggtgtcgacgtagttcttcgt Protospacer
*** ****** ***************.
674. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
acgttctcgattgcgtgggcgtcggcgtacgt Protospacer
** ****** **.************* *.
675. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
atgcgggcgatcccgcgggcgtcggcggccgc Protospacer
.* ** ****.*************** **
676. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
acgttctcgattgcgtgggcgtcggcgtacgt Protospacer
** ****** **.************* *.
677. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
atgcgggcgatcccgcgggcgtcggcggccgc Protospacer
.* ** ****.*************** **
678. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75
ttccgcttctgacgagccgaacgcc--gctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgcctg-- Protospacer
***.************** **** **..*
679. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to MH077578 (Mycobacterium phage DillTech15, complete genome) position: , mismatch: 8, identity: 0.75
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac Protospacer
.. *.* **** ******************
680. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to MT684586 (Mycobacterium phage Gandalph, complete genome) position: , mismatch: 8, identity: 0.75
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac Protospacer
.. *.* **** ******************
681. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 8, identity: 0.75
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac Protospacer
.. *.* **** ******************
682. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 8, identity: 0.75
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggac Protospacer
.. *.* **** ******************
683. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
gcttcgaccgcgcgggcgtcgtccacccggcg Protospacer
********* ************ * **
684. spacer 15.14|2279045|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75
gggttcacgggctgggcgaccgg----gaagcggtt CRISPR spacer
ggcttcacgggctcggcgaccggctccgtcgc---- Protospacer
** ********** ********* * **
685. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
tcaggggcgtgcgcacgaaggtggccgatgta Protospacer
**. .****** *.***************..
686. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
aggccagcgtgcgcgcgtaggtggccacgccg Protospacer
********** **** ********. **
687. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
ccacgaaggtgcccgtgaaggcggccgatgca Protospacer
.*.* *. *******.*****.*********.
688. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
tcttgagcgggcccgcgaagctggccgaacca Protospacer
** . **** ********** ******* *.
689. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
gcgtcgtgatggccgcgaaggcggccgatgcg Protospacer
**.*. .** *********.**********
690. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.75
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
accttggccaaggcgcaggccaaggtcgactt Protospacer
. * * * ************ *****.****
691. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcg Protospacer
*** ********** ********* *
692. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
gcgcacgggcgccgacgtcgtcggtccttcg Protospacer
*** ********** ********* *
693. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcg Protospacer
*** ********** ********* *
694. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
caagacgggcgccgacgtcgtcggggtcgcg Protospacer
..********** *********** * *
695. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NC_048046 (Caulobacter phage CcrPW, complete genome) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
acggcgtggcgccgccgacgtcggcgaagat Protospacer
.**. ********** ****** *****
696. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to JX100810 (Caulobacter phage CcrColossus, complete genome) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
acggcgtggcgccgccgacgtcggcgaagat Protospacer
.**. ********** ****** *****
697. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 8, identity: 0.742
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
gcatgtcggcgtcgccgtcgtcgaggaagac Protospacer
**. .. ****.***********.******
698. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.765
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
cggcaactcacgccgccgcacccccgcccccgcc Protospacer
* * **. *******.* **************
699. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.765
ccggta-ccgccgccgccacccccccgcccccgcc CRISPR spacer
-cgctgcccgccgccgccagcaccccgccccacca Protospacer
** *. ************ * ********* *
700. spacer 15.26|2278559|35|NZ_LN868939|PILER-CR matches to JX878496 (Serratia phage phiMAM1, complete genome) position: , mismatch: 8, identity: 0.771
cgcggtcaggctggtgttgatctcgctgatctggc CRISPR spacer
ggtgccaaggctggtgttgatcgtgctgatctgac Protospacer
*.* . *************** .*********.*
701. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gagtgaacccaccaccaccaccgaggcggcga Protospacer
. ..****************** ****.**
702. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gatcaccgccacgaccaccagcgcggcgacgc Protospacer
..** **** ******* ***********
703. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gaccgtcgccaccgtcaccaccgcggcgacgc Protospacer
.**. *****..*****************
704. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgcgccctccaccaccacctccgcggtgacgg Protospacer
*** .*********** ******.****
705. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP023670 (Methylomonas koyamae strain LM6 plasmid pLM6, complete sequence) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgccaaaaccacctccaccaccgtagccgccg Protospacer
******* ***** *********..** .*
706. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to KU984979 (Propionibacterium phage PFR1, complete genome) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgcaccggccaccatcaccacggcggcgacga Protospacer
*** . ******.****** *********
707. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_031108 (Propionibacterium phage PFR2, complete genome) position: , mismatch: 8, identity: 0.75
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgcaccggccaccatcaccacggcggcgacga Protospacer
*** . ******.****** *********
708. spacer 15.30|2278800|35|NZ_LN868939|PILER-CR matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 8, identity: 0.771
gccgaggtcgattccgcgggcgtcggcgtaggcat CRISPR spacer
ggtggtgtcgattccacgggcatcggcgtaggcga Protospacer
* .*. *********.*****.***********.
709. spacer 15.37|2279227|35|NZ_LN868939|PILER-CR matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.771
ctcgccagcgtgcccgcgaaggtggccgatgcggt CRISPR spacer
cgcgtcgtgatggccgcgaaggcggccgatgcggt Protospacer
* **.*. .** *********.************
710. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765
cgcgaacg-ggcgccgccgtcgtcggggaagaggt CRISPR spacer
-tcgatcacttcgccgccgtcgtcgggtacgaggt Protospacer
*** *. **************** * *****
711. spacer 15.44|2278499|34|NZ_LN868939|CRT matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 8, identity: 0.765
-cgaattgggtatcgaaatggtttgccacgtcagc CRISPR spacer
gcgta-tgggcatcgaaatgggttgccacggggtc Protospacer
** * ****.********** ******** . *
712. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
aagtcgccgaccaccaccaccgcgacgacgc Protospacer
. .** ***************.******
713. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cacgacagcaccaccaccacctcggcgacgg Protospacer
*.* ************* ********
714. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to MN694695 (Marine virus AFVG_250M866, complete genome) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
accaaaaccaccaccaccaccgccaccagca Protospacer
.***** **************** .* *
715. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ccaaaacgcaccagcaccaccgcggcaatcg Protospacer
* **** ***** ************.*.
716. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
acgccaccgcccaccaccaccgcggcgagga Protospacer
.* *** ****************** *
717. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
--gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgaccggg--caccaccacaaccgcggcggcgc Protospacer
.**... ********* *********.***
718. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP026696 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
accaatcccaccaccaccgccgcgattgggc Protospacer
.**** ************.*****.. . **
719. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gcgcgggccaccgccaccacggcggcgacgt Protospacer
** .. *****.******* *********.
720. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gcgccctccaccaccacctccgcggtgacgg Protospacer
** .*********** ******.****
721. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to KU984979 (Propionibacterium phage PFR1, complete genome) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gcaccggccaccatcaccacggcggcgacga Protospacer
** . ******.****** *********
722. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_031108 (Propionibacterium phage PFR2, complete genome) position: , mismatch: 8, identity: 0.742
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gcaccggccaccatcaccacggcggcgacga Protospacer
** . ******.****** *********
723. spacer 15.49|2278801|34|NZ_LN868939|CRT matches to NC_048021 (Gordonia phage Daredevil, complete genome) position: , mismatch: 8, identity: 0.765
ccgaggtcgattccgcgggcgtcggcgtaggcat CRISPR spacer
gtggtgtcgattccacgggcatcggcgtaggcga Protospacer
.*. *********.*****.***********.
724. spacer 15.51|2278923|34|NZ_LN868939|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.765
ttccgcttctgacgagccgaacgc---cgctcggtat CRISPR spacer
ctcagcttctgaggagccgaacgcccactctcga--- Protospacer
.** ******** *********** * ****.
725. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 8, identity: 0.765
ccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
ccggggatgggttgggcgtcgtcctcgacgacaa Protospacer
** **. ***.*************** ****
726. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 8, identity: 0.765
tcgccagcgtgcccgcgaaggtggccgatgcggt CRISPR spacer
gcgtcgtgatggccgcgaaggcggccgatgcggt Protospacer
**.*. .** *********.************
727. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
tcgccagcgtgcccgcgaaggtggccgatgcggt CRISPR spacer
acgccagcgcgcccgagaaggtggcgctggcgtt Protospacer
********.***** ********* *** *
728. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.765
tcgccagcgtgcccgcgaaggtggccgatgcggt CRISPR spacer
tcaggggcgtgcgcacgaaggtggccgatgtagt Protospacer
**. .****** *.***************..**
729. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcgat Protospacer
*** ********** ********** *.*
730. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 8, identity: 0.758
gcgaacgggcgccgccgtcgtcggg-----gaagaggt CRISPR spacer
gcgcacgggcgccgacgtcgtcgggccttcgag----- Protospacer
*** ********** ********** **.
731. spacer 15.59|2279410|36|NZ_LN868939|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.778
ccggtaccgccgccgccacccccccgcccccgccgt CRISPR spacer
ccaggcccgccgccgccagcaccccgcccccgacca Protospacer
**.* ************ * *********** *
732. spacer 16.2|2651215|30|NZ_LN868939|CRT matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.733
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggcgtggtcccaggtccctac Protospacer
***********.**** ******* .
733. spacer 16.4|2651299|30|NZ_LN868939|CRT matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.733
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggcgtggtcccaggtccctac Protospacer
***********.**** ******* .
734. spacer 16.6|2651383|30|NZ_LN868939|CRT matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.733
gggggaccaggtgtgggcccaggtggggga CRISPR spacer
gggggaccaggcgtggtcccaggtccctac Protospacer
***********.**** ******* .
735. spacer 5.2|1449429|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.719
gtcaagccgaagaaggctcaggtcacgatgcg CRISPR spacer
tggaagccgaagaaggcccaggtcccgtgggc Protospacer
**************.****** ** *
736. spacer 5.3|1449490|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 9, identity: 0.719
ttaccggtctcgttgcggaccagtgtcaaccc CRISPR spacer
aatagggtctcgttgctgaccagtatcagtcc Protospacer
*********** *******.***..**
737. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
gacctggcggtcgcggttcggtccggctgtca Protospacer
*. ************** ******** . .
738. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
gcctcggcggtcgcggtggggagcggcgcgcc Protospacer
* ..**************** ******
739. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
tccctttgtgtcgcggtgcggtccggcggcgg Protospacer
** ********* ********* ***
740. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039426 (Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
gctgtggcggtcgcggtggtggccggcccacc Protospacer
* *************** * ***** *
741. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
ggcgcctcggtcgggctggggtccggcgccaa Protospacer
** . ****** * **************..
742. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
ctgctggcggtcgcggtggcgttcgcggtgag Protospacer
***************** **.** *. .*
743. spacer 5.4|1449551|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039431 (Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gggctggcggtcgcggtggggtccggcgccgg CRISPR spacer
gctgtggcggtcgcggtggtggccggcccacc Protospacer
* *************** * ***** *
744. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP023492 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed2, complete sequence) position: , mismatch: 9, identity: 0.71
tgctcgaaggagacgacaaagccgcaatccg CRISPR spacer
tgatcgaaggagacgacaaagcaaggctttc Protospacer
** ******************* . . *..
745. spacer 6.1|1456893|31|NZ_LN868939|CRT matches to NZ_CP026507 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed2, complete sequence) position: , mismatch: 9, identity: 0.71
tgctcgaaggagacgacaaagccgcaatccg CRISPR spacer
tgatcgaaggagacgacaaagcaaggctttc Protospacer
** ******************* . . *..
746. spacer 6.2|1456953|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_015579 (Novosphingobium sp. PP1Y plasmid Lpl, complete sequence) position: , mismatch: 9, identity: 0.719
tgcggcgtgccgaaacggggaatc--gagcagcc CRISPR spacer
ggcggcgtgccgcaacgaggaatcttcgacaa-- Protospacer
*********** ****.****** ..**.
747. spacer 6.3|1457014|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttgaggctggagcgggaactccggcctcaagg CRISPR spacer
gggaggctggagcgggaactgcggcagggcag Protospacer
****************** **** . .*
748. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
accggcacgctgctcgacggctttctgagctg CRISPR spacer
aacggcacgctgctctatggctttcatcccga Protospacer
* ************* *.******* * .
749. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
accggcacgctgctcgacggctttctgagctg CRISPR spacer
tccggcacgctgctcgagggcattgccctgtg Protospacer
**************** *** ** . **
750. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to MN234161 (Gordonia phage Toast, complete genome) position: , mismatch: 9, identity: 0.719
accggcacgctgctcgacggctttctgagctg CRISPR spacer
accggcaccctgctcgacgggttcttccgtac Protospacer
******** *********** **..* *.
751. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021407 (Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence) position: , mismatch: 9, identity: 0.719
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
gccgctcaggaccccgaccccgacggcggctc Protospacer
.** . *** ***.***************
752. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
acctacgaggtccctgaccccgacggcggcga CRISPR spacer
gtggtcggtgtcccggaccccgactgcggcga Protospacer
.. **. ***** ********* *******
753. spacer 6.8|1457319|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 9, identity: 0.719
acctacg-----aggtccctgaccccgacggcggcga CRISPR spacer
-----cggattcaggtctatgaccccgacggcggcct Protospacer
** *****. ****************
754. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7
acggaggccgccccggtcgggcgcaaatgg CRISPR spacer
gagcaggccgcgccggtcgggcgcatgctc Protospacer
. * ******* ************* ..
755. spacer 8.1|1876546|30|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
acggaggccgccccggtcgggcgcaaatgg CRISPR spacer
gcgaaggccgccccggtcgcgcgccctcac Protospacer
.**.*************** **** ..
756. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
tcggatcggcctgagccggggcgccctgcgtggtg- CRISPR spacer
ccggatcggccagggccggggcgcccc-cgctctac Protospacer
.********** *.************. **. *.
757. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.743
tcggatcggcctgagccggggcgccctgcgtggtg- CRISPR spacer
ccggatcggccagggccggggcgcccc-cgctctac Protospacer
.********** *.************. **. *.
758. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
tcggatcggcctgagccggggcgccctgcgtggtg- CRISPR spacer
ccggatcggccagggccggggcgcccc-cgctctac Protospacer
.********** *.************. **. *.
759. spacer 10.1|1970147|35|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
tcggatcggcctgagccggggcgccctgcgtggtg CRISPR spacer
ccggatcggccagggccggggcgcccgctctactg Protospacer
.********** *.************ . *. **
760. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgacgcattcgccgaggccgtcgcggccg Protospacer
****** ** ************* * ...*
761. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
gcgcgaagccgtcgccgaagccgaggaaggga Protospacer
********* *******.*****.*.*.
762. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cgccgacgccttcgcccaggccgaagcccgcg Protospacer
* *** ********* ********* *
763. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to JQ067087 (Pseudomonas phage PaMx11, complete genome) position: , mismatch: 9, identity: 0.719
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
gtacgacgccttcgccgaggccggagaggtgc Protospacer
..*** ****************.**...* *
764. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MT664984 (Xanthomonas phage Xp12, complete genome) position: , mismatch: 9, identity: 0.719
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
cctcgacgccttcgccgaggccgcgttctccc Protospacer
** *** **************** . .**
765. spacer 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719
gggaccgacgtggcgcgtgccgaggaattcga CRISPR spacer
ctggacgacgtggagcgcgccgaggaatcagt Protospacer
*. ******** ***.**********. *
766. spacer 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719
gggaccgacgtggcgcgtgccgaggaattcga CRISPR spacer
ctggacgacgtggagcgcgccgaggaatcagt Protospacer
*. ******** ***.**********. *
767. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
cgcggcacccgcaccgaggccgacgccgccgt Protospacer
* *. **** ********.*********
768. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_009660 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD02, complete sequence) position: , mismatch: 9, identity: 0.719
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
accgcagcccccaccgaggacgacgcctcggt Protospacer
**....************ ******* **
769. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc Protospacer
* * ***** *********** *****. .
770. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc Protospacer
* * ***** *********** *****. .
771. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ttctgggcgaagcgggcgagggccgccgggcc Protospacer
* *************** * ******.
772. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc Protospacer
* * ***** *********** *****. .
773. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ttctgggcgaagcgggcgagggccgccgggcc Protospacer
* *************** * ******.
774. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
accttggcgacgccggcgatgcccgccgccga Protospacer
. * ***** ** ************** *..
775. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044475 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
776. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044446 (Acinetobacter indicus strain CMG3-2 plasmid pCMG3-2-1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
777. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049912 (Diaphorobacter sp. HDW4A plasmid p_unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
agcggcgcgaagcgggcgatgcccagcgcttc Protospacer
.**.* ******************. ** .
778. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044484 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
779. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc Protospacer
* * ***** *********** *****. .
780. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044451 (Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
781. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
gccttggcgatgcgggcgatgcgcgccggggc Protospacer
* * ***** *********** *****. .
782. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047350 (Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
783. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047345 (Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
784. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047353 (Proteus mirabilis strain ZA25 plasmid pZA25-tetX-168kb, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
785. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
accttggcgacgccggcgatgcccgccgccga Protospacer
. * ***** ** ************** *..
786. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
787. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
accttggcgacgccggcgatgcccgccgccga Protospacer
. * ***** ** ************** *..
788. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to CP046596 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
789. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
accttggcgacgccggcgatgcccgccgccga Protospacer
. * ***** ** ************** *..
790. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
cggttggcgtagtgggcgatgcccgccgctat Protospacer
* **** **.*************** .*
791. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
accttggcgacgccggcgatgcccgccgccga Protospacer
. * ***** ** ************** *..
792. spacer 11.5|2140585|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_002112 (Streptomyces cyaneus plasmid pSA1.1, complete sequence) position: , mismatch: 9, identity: 0.719
tacgagagcaaggggatcggcctggtcctcat CRISPR spacer
cagcgggtcaagggcgtcggcctggtcctcaa Protospacer
.* .*. ****** .***************
793. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 9, identity: 0.719
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
ctgaagctgctgaccgaggagcacggggcgat Protospacer
* ******************* *** .
794. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
tgccgggagctgaccgaggaggtcctggccgt Protospacer
. * * ************* ********
795. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.719
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
gagccgctgctgaccgtcgagcagccaaaggt Protospacer
**************** ***** *... *
796. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_047851 (Brevibacterium phage LuckyBarnes, complete genome) position: , mismatch: 9, identity: 0.719
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
ggatgccacctgatcgagtagcacctggccgg Protospacer
*... * ****.**** *************
797. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN813684 (Microbacterium phage Terij, complete genome) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
gcatccgcgcgatccgcgacgccctcggtcgg Protospacer
***** ******* **********. . *
798. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
gggcggaggcgatcctcgacgaccccaccgtc Protospacer
*.. .************** **.***** *
799. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_011991 (Agrobacterium vitis S4 plasmid pAtS4b, complete sequence) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
gcaccttggcgatcctcgacgcgttcaccgca Protospacer
*.*. *************** .******
800. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
gcgtcgcggccaccctcgacgccctcaccgag Protospacer
.** *** *.*****************.
801. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH834618 (Arthrobacter phage Lunar, complete genome) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct Protospacer
* . ***** ***********.*****.* .
802. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MN234214 (Arthrobacter phage Amelia, complete genome) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct Protospacer
* . ***** ***********.*****.* .
803. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH834624 (Arthrobacter phage Polka, complete genome) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct Protospacer
* . ***** ***********.*****.* .
804. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH834608 (Arthrobacter phage Cote, complete genome) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
tcgagcgggccatcctcgacgctctcactgct Protospacer
* . ***** ***********.*****.* .
805. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.719
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cggatcaggcgatccgcgatgccctcaccgat Protospacer
.*. .*.******** ***.**********..
806. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.719
cggccacggcgtcgcgtgtggaccggcggctc CRISPR spacer
cgcaaccggcgtcgggtgtggatcggcggtga Protospacer
** ******** *******.******.
807. spacer 12.6|2142745|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccacggcgtcgcgtgtggaccggcggctc CRISPR spacer
cgcaaccggcgtcgggtgtggatcggcggtga Protospacer
** ******** *******.******.
808. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
ccgaagctgatcgtcgacaacctctcctgctt Protospacer
************** *.******.* .*
809. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
acggacctgatcctcgcctacctcttcacaac Protospacer
. *.* ****** ***** **********. .
810. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
cgcgacctgatcgccgccgaccccttcacacc Protospacer
. .* *******.********.******.*.
811. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 9, identity: 0.719
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
gaggaggtgatcgtcgccgacctggccgaccg Protospacer
***.** **************** .*. *
812. spacer 13.1|2153855|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.719
aggtgtcaaccggggcaccacacaccacaagg CRISPR spacer
cagcgctgaccggcgcaccactcaccacaaga Protospacer
.*.*...***** ******* *********.
813. spacer 13.1|2153855|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.719
aggtgtcaaccggggcaccacacaccacaagg CRISPR spacer
cagcgctgaccggcgcaccactcaccacaaga Protospacer
.*.*...***** ******* *********.
814. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ctgcgcgacacggtgacggcggtgcgcaccct Protospacer
****** ******.********** *
815. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021407 (Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gggcgcgagacgctggtggcggtgtcggatga Protospacer
************ ***.*******. * . .
816. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
tccccgtcgacggtggcgacggcgcggtggcg Protospacer
* **********.***.*********
817. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
tccaccacgacggtggcggcggtgccgcggcg Protospacer
*. ***************** *.****
818. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ctgcgcgacacggtgacggcggtgcgcaccct Protospacer
****** ******.********** *
819. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ctgcgcgacacggtgacggcggtgcgaaccct Protospacer
****** ******.**********. *
820. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gcgcgcgagacgctggcggcgctgcagatcga Protospacer
* ********** ******** ***.* .
821. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP018865 (Arthrobacter crystallopoietes strain DSM 20117 plasmid pLDW-10, complete sequence) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ccggtccggacggcggcggcggggcggtggcc Protospacer
* * .*****.******** ********
822. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT522004 (Mycobacterium phage Gail, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
gcggtggagaaggtggcggcggtgcgctgttc Protospacer
* * **** *************** ** .
823. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc Protospacer
.*******.***.*********** **
824. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_022063 (Mycobacterium phage Phelemich, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggtggcggcagtgctgacacc Protospacer
.*******.**********.**** * .*
825. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc Protospacer
.*******.***.*********** **
826. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc Protospacer
.*******.***.*********** **
827. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to KF024727 (Mycobacterium phage Reprobate, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggtggcggcagtgctgacacc Protospacer
.*******.**********.**** * .*
828. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 9, identity: 0.719
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacgcc Protospacer
.*******.***.*********** **
829. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgaacgtcgcgcacggcgcgtcgacggg Protospacer
**********.***** ******* * . .
830. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgaccgccgcgctgggcgcccgcccgag Protospacer
******* ********* ***** .*. *
831. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
832. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
833. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
834. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
835. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
836. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
837. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
838. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
839. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
840. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
841. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH976512 (Gordonia phage Geodirt, complete genome) position: , mismatch: 9, identity: 0.719
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
ggcgcgctcgccgcgctcggcgcactgatcga Protospacer
****** ***************. . **.
842. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
ccggtgacgccgcccgtggtgttggccgcgac Protospacer
. .* *****************.*****
843. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg Protospacer
. *******.********** ***** ..*..
844. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg Protospacer
. *******.********** ***** ..*..
845. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
846. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
847. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
848. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
849. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
850. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
851. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
852. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
853. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tcccgaccgccgcccgtgccgttgaccgcgag Protospacer
.* ************ .********** .
854. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg Protospacer
. *******.********** ***** ..*..
855. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
aacatcccgtcgcccgtggtcttgacgatgcg Protospacer
. *******.********** ***** ..*..
856. spacer 13.7|2154221|32|NZ_LN868939|CRISPRCasFinder,CRT matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcccgccgcccgtggtgttgaccgcgta CRISPR spacer
tgcggttcgccgcccgtggtgatgcccgcgaa Protospacer
*. ..************** ** ***** *
857. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NZ_CP035418 (Leisingera sp. NJS204 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
cccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
cccgcgacatgctgcagcggctgaccaatgcgga Protospacer
******* ****** *********. ** .* .
858. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NC_015852 (Acidithiobacillus caldus SM-1 plasmid pLAtc1, complete sequence) position: , mismatch: 9, identity: 0.735
cccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
accgggagaagctggagcggctgattcatgacgg Protospacer
*** **** *************** * . * *
859. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.735
cccagccgccgctcatgatcggcgaggaacatca-- CRISPR spacer
cccagtcgccgctgatgatcggcgcg--acggtgat Protospacer
*****.******* ********** * **. ..
860. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to KX576640 (Arthrobacter phage RcigaStruga, complete genome) position: , mismatch: 9, identity: 0.735
cccagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
aggagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
861. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MG210949 (Arthrobacter phage Huntingdon, complete genome) position: , mismatch: 9, identity: 0.735
cccagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
aggagccgccgctcacgaccggcgagg-tcttcgt Protospacer
************.**.******** * **.
862. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MK112529 (Arthrobacter phage BigMack, complete genome) position: , mismatch: 9, identity: 0.735
cccagccgccgctcatgatcggcgaggaacatca- CRISPR spacer
tggagccgccgctcacgaccggcgagg-tcttcgt Protospacer
. ************.**.******** * **.
863. spacer 14.6|2163935|34|NZ_LN868939|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ccagcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
atcgcccagcgcagcgaccaggcgaccagcggca Protospacer
. ***************** ******* * .
864. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.735
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
tgccgttcaacccggccggcatgaccgccgtccc Protospacer
. * ***.*********.***********. .*
865. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
acgccttcgacccgtccgacaggacgtaggtgcc Protospacer
************* ****** *** *.*.*
866. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 9, identity: 0.735
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
acctggtcaacccggccgacctgaccgccgagac Protospacer
* . **.*********** ********* * *
867. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 9, identity: 0.735
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
acctggtcaacccggccgacctgaccgccgagac Protospacer
* . **.*********** ********* * *
868. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.735
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
acctggtcaacccggccgacctgaccgccgagac Protospacer
* . **.*********** ********* * *
869. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 9, identity: 0.735
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
gccccggcgtcccggccgacaagaccgccgccgt Protospacer
* ** ** *********** ********* .
870. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 9, identity: 0.735
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
tgggcggtaacacccgcaccgtcaccacgccgta Protospacer
. *****.* *****************. * *.
871. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
tgggcggcaacacacgcaccgtcaccacgccgta Protospacer
. ******* *** *************. * *.
872. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.735
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
cgggcggcatcacgctcaccgtcaccgacaacgg Protospacer
* *********** * **********. * *
873. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 9, identity: 0.735
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
tcggcggcagcacccgcaccgccacgaccgacgc Protospacer
.******** ***********.*** *.* * .
874. spacer 14.12|2164301|34|NZ_LN868939|PILER-CR matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 9, identity: 0.735
ccggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
atggcggcatcatccgcaccatcaccgtgacgcg Protospacer
.**********.*******.*****.* **
875. spacer 14.14|2164423|34|NZ_LN868939|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.735
ccccgatgaccgccatcccgccacccaagcggac CRISPR spacer
ccccgatgcccgccgtcccgccaccatgccgcga Protospacer
******** *****.********** . ** .
876. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
attgagctgctggatcggctgatgaagaaagc Protospacer
.*** ******* *************
877. spacer 14.18|2163632|32|NZ_LN868939|CRISPRCasFinder matches to NZ_KY000038 (Agrobacterium rhizogenes strain 1724 plasmid pRi_1724, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgagatgctggagcggctgatgaagacccg CRISPR spacer
ctgtcgctgctggcgctgctgatgaagaccgc Protospacer
* * ****** ** *************
878. spacer 14.19|2163693|32|NZ_LN868939|CRISPRCasFinder matches to KU886270 (Freshwater phage uvFW-CGR-AMD-COM-C429, complete genome) position: , mismatch: 9, identity: 0.719
gcaattttggtggcgtgctcgtagtagaccgg CRISPR spacer
accaggttggtagcgtgctcgcagtagacacc Protospacer
.* * *****.*********.*******
879. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
ctcgatcagcgcatgatcggcgaggaacttcc Protospacer
* * ** ***************** **
880. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
accattctgcagcgaccacaggaccaggtggt Protospacer
* * . .*********** **********
881. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
accattctgcagcgaccacaggaccaggtggt Protospacer
* * . .*********** **********
882. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NC_018291 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_262, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg Protospacer
. .*************** * ***** * *
883. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010596 (Phaeobacter inhibens strain P10 plasmid pP10_a, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg Protospacer
. .*************** * ***** * *
884. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP031949 (Phaeobacter inhibens strain BS107 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg Protospacer
. .*************** * ***** * *
885. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
accattctgcagcgaccacaggaccaggtggt Protospacer
* * . .*********** **********
886. spacer 14.23|2163937|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010736 (Phaeobacter inhibens strain P72 plasmid pP72_a, complete sequence) position: , mismatch: 9, identity: 0.719
agcccagcgcagcgaccacccgaccaggtggg CRISPR spacer
cagtcagcgcagcgaccacaccaccagcggtg Protospacer
. .*************** * ***** * *
887. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
cgcctcgacccggccgacgtcaccgccgaacg Protospacer
*.**************.* ******* ..
888. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NC_024972 (Micrococcus sp. A1 plasmid pLMA1, complete sequence) position: , mismatch: 9, identity: 0.719
gccttcgacccggccgacatgaccgccgcgtc- CRISPR spacer
cgactcgaccccgccgacaggaccgcc-tgccg Protospacer
.******* ******* ******* .*.*
889. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
aggccggccacggccgcgccaccggcatcgcc Protospacer
. * . **********.***.******** *
890. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to NC_048133 (Aeromonas phage ZPAH7, complete genome) position: , mismatch: 9, identity: 0.719
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tggcagacgacggcagcaccatcggcattggc Protospacer
* .. * ***** *************.***
891. spacer 14.28|2164242|32|NZ_LN868939|CRISPRCasFinder matches to MK330684 (Aeromonas phage ZPAH7B, complete genome) position: , mismatch: 9, identity: 0.719
gcgagacccacggccgcaccatcggcatcggc CRISPR spacer
tggcagacgacggcagcaccatcggcattggc Protospacer
* .. * ***** *************.***
892. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct-- CRISPR spacer
cgcggcagcagccgcaccgtcacc--tcggtcac Protospacer
****** ** ************* .*.*..
893. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
gacagcatcacccgcaacatcaccatctccaa Protospacer
*.*.************ *.********.
894. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN270889 (Ralstonia phage P-PSG-11, complete genome) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
895. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN270890 (Ralstonia phage P-PSG-11-1, complete genome) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
896. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN685189 (UNVERIFIED: Ralstonia phage vRsoP-WF2 genomic sequence) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
897. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MF979559 (Ralstonia phage DU_RP_I, complete genome) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
898. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN693531 (Marine virus AFVG_25M28, complete genome) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccat--ccagct CRISPR spacer
tcaagcatcaccggcaccggcaccatcaccgg-- Protospacer
.******** ****** ****** **.*
899. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN685191 (UNVERIFIED: Ralstonia phage vRsoP-WR2 genomic sequence) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
900. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to MN685190 (UNVERIFIED: Ralstonia phage vRsoP-WM2 genomic sequence) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
901. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NC_047946 (Ralstonia phage RsoP1EGY, complete genome) position: , mismatch: 9, identity: 0.719
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
ttcggcatcacccgcaaggtcaccaagcggag Protospacer
************** ******* *.*
902. spacer 14.31|2164425|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgatgaccgccatcccgccacccaagcggac CRISPR spacer
ccgatgcccgccgtcccgccaccatgccgcga Protospacer
****** *****.********** . ** .
903. spacer 14.32|2164486|32|NZ_LN868939|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.719
cggtcctcacccgtgtcgggcccgcggtactg CRISPR spacer
ggcgtctctcccgtgtcgggcccgctgtcggg Protospacer
* .*** **************** ** *
904. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg Protospacer
** .. *****.****.************
905. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
gctgtcaccagcgtccagagttcgtcctcggg Protospacer
* . *. ************ ***.******
906. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
tggaattgcagcgtccagaggtcgcagatgcc Protospacer
* ***. ****************** .* .
907. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg Protospacer
** .. *****.****.************
908. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg Protospacer
** .. *****.****.************
909. spacer 14.33|2164547|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaacggcagcgtccagaggtcgccctcggt CRISPR spacer
tcccgtcccagcgcccaggggtcgccctcggg Protospacer
** .. *****.****.************
910. spacer 14.46|2164302|33|NZ_LN868939|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
cggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
gggcggcatcacgctcaccgtcaccgacaacgg Protospacer
*********** * **********. * *
911. spacer 14.48|2164424|33|NZ_LN868939|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.727
cccgatgaccgccatcccgccacccaagcggac CRISPR spacer
cccgatgcccgccgtcccgccaccatgccgcga Protospacer
******* *****.********** . ** .
912. spacer 14.49|2164485|33|NZ_LN868939|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.727
ccggtcctcacccgtgtcgggcccg----cggtactg CRISPR spacer
acggtcctcacccgtgacgggaccgttgacgac---- Protospacer
*************** **** *** **..
913. spacer 14.49|2164485|33|NZ_LN868939|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.727
ccggtcctcacccgtgtcgggcccg----cggtactg CRISPR spacer
gcggtcctcacccgtgacggggccgttgacgac---- Protospacer
*************** **** *** **..
914. spacer 14.51|2164607|33|NZ_LN868939|CRT matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 9, identity: 0.727
ccagccagcagcgaatgcgttggcggtcagcat CRISPR spacer
gaagccagcaacgaatgcgatggcggtggttgt Protospacer
********.******** ******* . ..*
915. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
916. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
917. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
918. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
919. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
920. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
921. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
922. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
923. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
924. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
925. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
926. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
927. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
928. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
929. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
930. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
931. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
932. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
933. spacer 15.3|2278377|32|NZ_LN868939|CRISPRCasFinder matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 9, identity: 0.719
gcatggaccccggccacatgcgcggcttcata CRISPR spacer
ccctggacgccgcccacatgcgcggctgggac Protospacer
* ***** *** ************** .
934. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719
cgaattgggtatcgaaatggtttgccacgtca CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc Protospacer
*.* ** *************.****** .
935. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719
cgaattgggtatcgaaatggtttgccacgtca CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc Protospacer
*.* ** *************.****** .
936. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719
cgaattgggtatcgaaatggtttgccacgtca CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc Protospacer
*.* ** *************.****** .
937. spacer 15.5|2278499|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 9, identity: 0.719
cgaattgggtatcgaaatggtttgccacgtca CRISPR spacer
caacgaggctatcgaaatggttcgccacgatc Protospacer
*.* ** *************.****** .
938. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggatcgcggctggtgtggatctcgttgatcag Protospacer
* . . ********* *******.***** *
939. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ctggctgcgctggtggtgatctggctgatctt Protospacer
.**... ******* ****** ********
940. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ctcaacgggctggtgttgatctcggcgatccg Protospacer
. . *.***************** .****.*
941. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MN871482 (UNVERIFIED: Pseudomonas virus PaSz-6, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc Protospacer
* . ****.************** *** *
942. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MN871486 (UNVERIFIED: Pseudomonas phage PaSz-9_45_61k, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc Protospacer
* . ****.************** *** *
943. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MN871456 (UNVERIFIED: Pseudomonas phage Pa-C, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc Protospacer
* . ****.************** *** *
944. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NC_010116 (Pseudomonas phage YuA, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc Protospacer
* . ****.************** *** *
945. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to MT118302 (Pseudomonas phage Epa38, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc Protospacer
* . ****.************** *** *
946. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to KC758116 (Pseudomonas phage LKO4, complete genome) position: , mismatch: 9, identity: 0.719
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
ggttcgaggccggtgttgatctcgcggatgtc Protospacer
* . ****.************** *** *
947. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.719
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
tgggtgaagatggcgcgggcgtcggcgtagga Protospacer
. *. * *** ******************
948. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013073 (Sphingobium indicum B90A plasmid pSRL3, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
949. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_014005 (Sphingobium japonicum UT26S plasmid pUT1, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
950. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
951. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
952. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020563 (Sphingomonas sp. MM-1 plasmid pISP4, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
953. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005088 (Sphingobium sp. TKS plasmid pTK4, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
954. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP005090 (Sphingobium sp. TKS plasmid pTK6, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
955. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020544 (Sphingomonas sp. MM-1 plasmid pISP3, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
956. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 9, identity: 0.719
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
gaccgtttctgacgagccgatcgccttgctgg Protospacer
***.************** **** . * *
957. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP014597 (Yangia sp. CCB-MM3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
atgccagcgtgcccgcgaagggggcacgcaag Protospacer
.******************* *** ... *
958. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
atttcagcttgcccgcgaaggtgcccggcgcc Protospacer
. .**** ************** ***..**
959. spacer 15.17|2279228|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049702 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgccagcgtgcccgcgaaggtggccgatgcg CRISPR spacer
acccaagcgcgcccgccaaggtggccgagaaa Protospacer
* * ****.****** *********** . .
960. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
cgattcgagacggcgcaggcccaggacatcgc Protospacer
. ****** ************** ** * .
961. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
atggtccagcaggcgcaggcccaggtcgagga Protospacer
. *** ** *****************.*
962. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccgg Protospacer
.************** **** ****. *
963. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP033037 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
aaaaccgagaaggcgcagtcgcaggtcaagcg Protospacer
.* ..************* * ******** .
964. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcg Protospacer
.* ..************* * ******** .
965. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcg Protospacer
.* ..************* * ******** .
966. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcg Protospacer
.* ..************* * ******** .
967. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NC_009669 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcg Protospacer
.* ..************* * ******** .
968. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.719
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccgg Protospacer
.************** **** ****. *
969. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
cgaaacgggcgcggccgtcgtcggcgatcgc Protospacer
.********* *********** ** .
970. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022081 (Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
971. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
972. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
973. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP034556 (Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
974. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to MT889376 (Arthrobacter phage Phives, complete genome) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
aggcgtgggcgtcgccgtcgtcgggcaagtc Protospacer
. * ..*****.************* ***
975. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
tcgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
976. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP023519 (Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
977. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007745 (Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgcacgggcgccgacgtcgtcggcccttcg Protospacer
** ********** ********* *
978. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
ccgaacgggcatcgccgtcgtcggccgaacc Protospacer
*********..************ .*.
979. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.71
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
aacattccgcgccgcggtcgccggggaagag Protospacer
. * . ******* ****.**********
980. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 9, identity: 0.735
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
ccctcatgtgcgacgccgcccccccgcccccgcc Protospacer
** .*. ** ****.****************
981. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.735
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
cgcttcccgccgccgccagcaccccgccccacca Protospacer
* * ************ * ********* *
982. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ccggccgcccaccgccaccaccgcggcggcga Protospacer
* .******.**************.**
983. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cttaccccccaccaacaccaccgcgtcgacgg Protospacer
* . ******* ********** *****
984. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP027240 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cagcccggccaccagcagcaccgcggcgacgg Protospacer
*. * . ****** ** *************
985. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP014515 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgccgaacccaccaccacccccgataccgggt Protospacer
****.************** *** .* . *.
986. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP025617 (Micrococcus luteus strain SGAir0127 plasmid pSGAir0127) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cagcccggccaccagcagcaccgcggcgacgg Protospacer
*. * . ****** ** *************
987. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gccaaaacgcaccagcaccaccgcggcaatcg Protospacer
* **** ***** ************.*.
988. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP026696 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP4, complete sequence) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gaccaatcccaccaccaccgccgcgattgggc Protospacer
.**** ************.*****.. . **
989. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ggcgcgggccaccgccaccacggcggcgacgt Protospacer
** .. *****.******* *********.
990. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to JN672684 (Enterobacteria phage F20, partial genome) position: , mismatch: 9, identity: 0.719
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
cgccataaccaccaccaccaccgatcataaac Protospacer
***** * *************** * .*
991. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 9, identity: 0.735
cgcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
ggcgcacgggcgccgacgtcgtcgggccttcgat Protospacer
*** ********** ********** *.*
992. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP011506 (Burkholderia pyrrocinia strain DSM 10685 plasmid p2327, complete sequence) position: , mismatch: 9, identity: 0.735
cgcgaacgggcgccgccgtcgtcggg-----gaagaggt CRISPR spacer
ggcgcacgggcgccgacgtcgtcgggccttcgag----- Protospacer
*** ********** ********** **.
993. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735
cgcg-aacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
-gcgaaacgggcgcggccgtcgtcggcgatcgccc Protospacer
*** ********* *********** ** . .
994. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 9, identity: 0.71
------gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ctgtttgcca---ccaccaccaccgccgcgacaa--- Protospacer
**** ***********.*****.*.*
995. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
ttaccccccaccaacaccaccgcgtcgacgg Protospacer
. ******* ********** *****
996. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP027240 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcccggccaccagcagcaccgcggcgacgg Protospacer
. * . ****** ** *************
997. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP025617 (Micrococcus luteus strain SGAir0127 plasmid pSGAir0127) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
agcccggccaccagcagcaccgcggcgacgg Protospacer
. * . ****** ** *************
998. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tcgcgggtcaccaccaccaccgcgccgaggc Protospacer
* .. .**************** *** **
999. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gggaaacccaccaccaccacctctgcccata Protospacer
* ****************** * **
1000. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gggaaacccaccaccaccacctctgcccata Protospacer
* ****************** * **
1001. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
gccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
gggaaacccaccaccaccacctctgcccata Protospacer
* ****************** * **
1002. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 9, identity: 0.735
ccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
agtcggaccggttgggcgtcgtcctcgaagaggg Protospacer
*. *******.***************.** .
1003. spacer 15.53|2279045|34|NZ_LN868939|CRT matches to NZ_CP044987 (Deinococcus sp. AJ005 plasmid p96k, complete sequence) position: , mismatch: 9, identity: 0.735
gggttcacgggctgggcgaccgggaagcggttat CRISPR spacer
ggttgaccgggctgagcgaccgggacgcggtgga Protospacer
** * *******.********** ***** .
1004. spacer 15.56|2279228|34|NZ_LN868939|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
tcgccagcgtgcccgcgaaggtggccgatgcggt CRISPR spacer
aggccagcgtgcgcgcgtaggtggccacgccgga Protospacer
********** **** ********. ***
1005. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 9, identity: 0.735
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
accttggccaaggcgcaggccaaggtcgacttgc Protospacer
. * * * ************ *****.*****.
1006. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.735
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
gcggtcgagcaggcgcaggcgcaggtcggcgttg Protospacer
* ****** ********** ******..* *
1007. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcgat Protospacer
*** ********** ********* *.*
1008. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 9, identity: 0.727
gcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
gcgcacgggcgccgacgtcgtcggtccttcgat Protospacer
*** ********** ********* *.*
1009. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgaacgggcgccgccgtcgtcgg-----ggaagaggt CRISPR spacer
gcgcacgggcgccgacgtcgtcggcccttcgag----- Protospacer
*** ********** ********* **.
1010. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727
gcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
tccaggtctcgccgccgtcctcggtgaagaggt Protospacer
* *. ********** **** ********
1011. spacer 16.7|2651431|30|NZ_LN868939|CRT matches to NZ_CP014769 (Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
cctcgaccagttgcgggccaaggtgggctt Protospacer
****** ******** *******
1012. spacer 16.8|2651479|30|NZ_LN868939|CRT matches to NZ_CP014769 (Hymenobacter sp. PAMC 26554 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
gggggaccaggtgcgggcccaggtggggga CRISPR spacer
cctcgaccagttgcgggccaaggtgggctt Protospacer
****** ******** *******
1013. spacer 5.5|1449612|32|NZ_LN868939|CRISPRCasFinder,CRT,PILER-CR matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688
ctcatgctgtgctcgcgggcggggttggcccg CRISPR spacer
gcaatgctgtgctcggtggcggggttcttgct Protospacer
. ************ ********* . *
1014. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc Protospacer
*. .***.****.**************..
1015. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
taaggcacggtggtcaggccgcatcgtttgcg Protospacer
...************.****** *** .*
1016. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018665 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc Protospacer
*. .***.****.**************..
1017. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
taaggcacggtggtcaggccgcatcgtttgcg Protospacer
...************.****** *** .*
1018. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1019. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc Protospacer
*. .***.****.**************..
1020. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1021. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1022. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1023. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1024. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1025. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1026. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1027. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1028. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1029. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1030. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to CP021185 (Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
ggattagcggcggtcaggccgcctcgaggatc Protospacer
*. .***.****.**************..
1031. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
taaggcacggtggtcaggccgcatcgtttgcg Protospacer
...************.****** *** .*
1032. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1033. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
aggggctcggtggtccggccgccttcaccctc Protospacer
***** ******** ********. * ..
1034. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
ccgggcacggtggtctggcagcctccgatcgg Protospacer
* ************* *** ***** ..
1035. spacer 6.6|1457197|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688
cggggcacggtggtcgggccgcctcgaggact CRISPR spacer
gttcatgcgatggtcgggccgcctcgcggagt Protospacer
...**.**************** *** *
1036. spacer 6.10|1457441|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
gtcgagggggtgcgggtgcccgcggcgccgcc CRISPR spacer
atgatctcggcgcgggtgcccgcggcgtcgcg Protospacer
.* . **.****************.***
1037. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.688
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcaaagccttcgacgaggccgtcagcggtt Protospacer
****.********* ******** .* . ..
1038. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 10, identity: 0.688
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgacgccgtcgccgaggccggttaccccg Protospacer
****** *** ************. . .*
1039. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccgcgaagccttcgccgcggtcggcacggctc Protospacer
***************** **.**. . ....*
1040. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ccccgaagccttcgccgatgccgtgaccgaac Protospacer
** *************** **** .. . *
1041. spacer 11.1|2140341|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.688
ccgcgaagccttcgccgaggccgaaggaatcc CRISPR spacer
ggttgctaccttcgacgaggccgaaggattca Protospacer
.* .****** ************* **
1042. spacer 11.2|2140402|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gggaccgacgtggcgcgtgccgaggaattcga CRISPR spacer
tttgccgacgtggcgcgtgctgcggaacgcac Protospacer
.****************.* ****. *.
1043. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK524525 (Mycobacterium phage Ringer, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1044. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MH371110 (Mycobacterium phage Magnar, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1045. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to AF271693 (Mycobacterium virus Bxb1, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1046. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MH697581 (Mycobacterium phage Crispicous1, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1047. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_028828 (Mycobacterium phage TheloniousMonk, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1048. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1049. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to MK524523 (Mycobacterium phage Naira, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1050. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_002656 (Mycobacterium phage Bxb1, complete genome) position: , mismatch: 10, identity: 0.688
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gacatgacccccgccgaggccgacgagatccg Protospacer
**********.******.***** .. .*
1051. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ctgagggcaaagggggcgatgcccgcccgttc Protospacer
*****.*** ************** ..
1052. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
ggcaggccgaggcgggcgatgccgcttatgtg Protospacer
****** ***.************ ... *
1053. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 10, identity: 0.688
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
tcctctatgaatcgggcgatgccctccgacat Protospacer
* ..*** ************ ******
1054. spacer 11.4|2140524|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggcagggcgaagcgggcgatgcccgccgacag CRISPR spacer
tcgagggcgaaccgggcgatacccgcacctat Protospacer
******** ********.***** .*
1055. spacer 12.1|2142440|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 10, identity: 0.688
gagccgctgctgaccgaggagcacctggccgg CRISPR spacer
accaagacgctgaccgaggagcagcaggccga Protospacer
. * .*************** * *****.
1056. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP029363 (Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence) position: , mismatch: 10, identity: 0.688
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cctggctggtgatcctcgacgacctcaccgat Protospacer
. * **.*********** ********..
1057. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_015147 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence) position: , mismatch: 10, identity: 0.688
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgatcccggcgatcctcgccgccccgggagcg Protospacer
.***** *********** *****. . *
1058. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
gccgcaaggcgatcgtcgacgccatcaccgcg Protospacer
* .******* ******** ******
1059. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_019331 (Arthrobacter sp. J3-40 plasmid pJ340-114, complete sequence) position: , mismatch: 10, identity: 0.688
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgatcccggcgatcctcgccgcccctggagca Protospacer
.***** *********** *****... *
1060. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_019332 (Arthrobacter sp. J3-53 plasmid pJ353-116, complete sequence) position: , mismatch: 10, identity: 0.688
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgatcccggcgatcctcgccgcccctggagca Protospacer
.***** *********** *****... *
1061. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
gcgttatggcgatcctcgacggcctcatcgag Protospacer
.*. ************** *****.**.
1062. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
tttggccggatcgtcgccgacctctgcgcgca Protospacer
.. * ***************** *.***
1063. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP020811 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgacacggtggccgcggtgcccgaccc Protospacer
.****** ******** ******* . *
1064. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
ttgcgcgagacggtggagacggtgcccccgat Protospacer
************** *.****** . *
1065. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 10, identity: 0.688
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cggcgcgacacggtggcggctgtgataggcaa Protospacer
******* *********** *** . * .
1066. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 10, identity: 0.688
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgacacggtggccgcggtgcccgaccc Protospacer
.****** ******** ******* . *
1067. spacer 13.3|2153977|32|NZ_LN868939|CRISPRCasFinder,CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 10, identity: 0.688
gggcgcgagacggtggcggcggtgcggtggcg CRISPR spacer
cagcgcgaggcggcggcggcggtgctcacacc Protospacer
.*******.***.*********** .*
1068. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
gccgcgaacgcctcgctcggcgtgaagtagcc Protospacer
* ********** *********.** . .
1069. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
agcgcgaacgccgcggtcagcgcggcgaaggc Protospacer
.************** **.*****.* ..
1070. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
agcgcgaacgccgcggtcagcgcggccaaggc Protospacer
.************** **.*****.*. ..
1071. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
agcgcgaacgccgcggtcagcgcggccaaggc Protospacer
.************** **.*****.*. ..
1072. spacer 13.5|2154099|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
ggcgcgaacgccgcgctcggcgcgactctcat CRISPR spacer
agcgcgaacgccgcggtcagcgcggccaaggc Protospacer
.************** **.*****.*. ..
1073. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca Protospacer
. * .******** ***** ********.
1074. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca Protospacer
. * .******** ***** ********.
1075. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca Protospacer
. * .******** ***** ********.
1076. spacer 13.6|2154160|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.688
gtgaacacggtgaccggcccgtaccggctgtt CRISPR spacer
agcacggcggtgacccgcccgaaccggctgca Protospacer
. * .******** ***** ********.
1077. spacer 14.15|2164484|34|NZ_LN868939|PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 10, identity: 0.706
cccggtcctcacccgtgtcgggcccg----cggtactg CRISPR spacer
aacggtcctcacccgtgacgggaccgttgacgac---- Protospacer
*************** **** *** **..
1078. spacer 14.15|2164484|34|NZ_LN868939|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706
cccggtcctcacccgtgtcgggcccg----cggtactg CRISPR spacer
agcggtcctcacccgtgacggggccgttgacgac---- Protospacer
*************** **** *** **..
1079. spacer 14.17|2164606|34|NZ_LN868939|PILER-CR matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 10, identity: 0.706
cccagccagcagcgaatgcgttggcggtcagcat CRISPR spacer
tgaagccagcaacgaatgcgatggcggtggttgt Protospacer
. ********.******** ******* . ..*
1080. spacer 14.21|2163815|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 10, identity: 0.688
gacacgaccctgcagcggatcgtgatcgcctg CRISPR spacer
aacacgaccctgcagcagatggtggcgcatta Protospacer
.***************.*** ***.. .*.
1081. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1082. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1083. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcattatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1084. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1085. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1086. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1087. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1088. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcattatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1089. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1090. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1091. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcattatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1092. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1093. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1094. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
gagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1095. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NC_041944 (Arthrobacter phage Preamble, complete genome) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
gagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1096. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to MH744421 (Arthrobacter phage Moki, complete genome) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
gagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1097. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1098. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1099. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1100. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1101. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP044329 (Methylocystis rosea strain BRCS1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
cagctggcgctcatgatcggcgatttctgcaa Protospacer
****.* **************** ... *
1102. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1103. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1104. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1105. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1106. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1107. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1108. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
gggccgccgcgcatggtcggcgaggtgcgcat Protospacer
.******** ****.********* .*..
1109. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1110. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1111. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1112. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1113. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1114. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1115. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1116. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1117. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1118. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1119. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1120. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1121. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1122. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1123. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1124. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1125. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1126. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1127. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1128. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1129. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1130. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1131. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
ctcgatccgctcgtggtcggcgaggaacacgc Protospacer
* ******.**.*************.
1132. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1133. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1134. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1135. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1136. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1137. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1138. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1139. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1140. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1141. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1142. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1143. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1144. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1145. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1146. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1147. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1148. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1149. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1150. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1151. spacer 14.22|2163876|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
cagccgccgctcatgatcggcgaggaacatca CRISPR spacer
tcgccgccgctcatcatcagcgaggcggaaat Protospacer
. ************ ***.****** . *
1152. spacer 14.25|2164059|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
gccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
tcgcccgacacggccggcatgaccgccggcgg Protospacer
* ..**** ******.***********
1153. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
atcggcatcgcccgcaccgtgaccaagcgcgg Protospacer
. *******.********** **** *.
1154. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
atcggcatcgcccgcaccgtgaccaagcgcgg Protospacer
. *******.********** **** *.
1155. spacer 14.29|2164303|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.688
ggcggcatcacccgcaccgtcaccatccagct CRISPR spacer
aacgccatcacccgcaccggcaccacgggctt Protospacer
..** ************** *****. . .*
1156. spacer 14.35|2163631|33|NZ_LN868939|CRT matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 10, identity: 0.697
ccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
gattgagctgctggatcggctgatgaagaaagc Protospacer
.*** ******* *************
1157. spacer 15.6|2278560|32|NZ_LN868939|CRISPRCasFinder matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 10, identity: 0.688
gcggtcaggctggtgttgatctcgctgatctg CRISPR spacer
gcggtcaggctggtgttggtgtccgcagttca Protospacer
******************.* ** ...*...
1158. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 10, identity: 0.688
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
atggaagagatttcgcgggcgtcggcgtcggt Protospacer
.*... ****.*************** **.
1159. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 10, identity: 0.688
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
atggaagagatttcgcgggcgtcggcgtcggt Protospacer
.*... ****.*************** **.
1160. spacer 15.12|2278923|32|NZ_LN868939|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688
ttccgcttctgacgagccgaacgccgctcggt CRISPR spacer
ctcagcttctgaggagccgaacgcccactctc Protospacer
.** ******** ************ .. .
1161. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP050072 (Klebsiella aerogenes strain 035 plasmid p35_E, complete sequence) position: , mismatch: 10, identity: 0.688
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
aacgaggttggtcgcgcgtcgtccttgaggac Protospacer
. *...***** **********.******
1162. spacer 15.13|2278984|32|NZ_LN868939|CRISPRCasFinder matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 10, identity: 0.688
ccttcgaccggtcgggcgtcgtcctcgaggac CRISPR spacer
aagccgaccggtgcggcgtcgtcctcggccaa Protospacer
.******** *************. *
1163. spacer 15.18|2279289|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 10, identity: 0.688
gacgtcgagaaggcgcaggcccaggtcaactt CRISPR spacer
acggtcgaccaggcgcaggcccaggtcggtcc Protospacer
. ***** *****************.....
1164. spacer 15.19|2279350|31|NZ_LN868939|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 10, identity: 0.677
gcgaacgggcgccgccgtcgtcggggaagag CRISPR spacer
aatgcagggcgtcgccgtcgacggggaagcc Protospacer
. . *****.******** ********
1165. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1166. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1167. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1168. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1169. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1170. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1171. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1172. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1173. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1174. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1175. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1176. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1177. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1178. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1179. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1180. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1181. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1182. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1183. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1184. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1185. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1186. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1187. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1188. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1189. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1190. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1191. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1192. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1193. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1194. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccacaccgccgccgccaccgccacgcccttgat Protospacer
.* ..*************** ** *****..* .
1195. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1196. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1197. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1198. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1199. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1200. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1201. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1202. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1203. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1204. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1205. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1206. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1207. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1208. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1209. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1210. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1211. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1212. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1213. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1214. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1215. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1216. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1217. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1218. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1219. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1220. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
gcttgaccgtcgccgccaccccctcgccctgcac Protospacer
* ****.*************.*****. *
1221. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1222. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1223. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ccggtacc----gccgccgccacccccccgcccccgcc CRISPR spacer
----tgacgtgggccgccgccaccgccccgcccgcgat Protospacer
*. * ************ ******** ** .
1224. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1225. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1226. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1227. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1228. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1229. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1230. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1231. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1232. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1233. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1234. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1235. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1236. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1237. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1238. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1239. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1240. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1241. spacer 15.20|2279410|34|NZ_LN868939|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
ccggtaccgccgccgccacccccccgcccccgcc CRISPR spacer
tccagaccgccgccgccaccgccacgcccttgat Protospacer
.* . *************** ** *****..* .
1242. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
atcgcgggtcaccaccaccaccgcgccgaggc Protospacer
* .. .**************** *** **
1243. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tgggaaacccaccaccaccacctctgcccata Protospacer
.* ****************** * **
1244. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tgggaaacccaccaccaccacctctgcccata Protospacer
.* ****************** * **
1245. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
cgccaaacccaccaccaccaccgcggcgacgc CRISPR spacer
tgggaaacccaccaccaccacctctgcccata Protospacer
.* ****************** * **
1246. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to HM486077 (Tsukamurella phage TPA2, complete sequence) position: , mismatch: 10, identity: 0.688
cgccaaacccaccaccaccaccgcggcgacgc--- CRISPR spacer
---cgagttcaccaccaccaccaccgcgccgccga Protospacer
*.*...*************.* *** ***
1247. spacer 15.28|2278681|32|NZ_LN868939|PILER-CR matches to NC_015210 (Tsukamurella phage TPA2, complete genome) position: , mismatch: 10, identity: 0.688
cgccaaacccaccaccaccaccgcggcgacgc--- CRISPR spacer
---cgagttcaccaccaccaccaccgcgccgccga Protospacer
*.*...*************.* *** ***
1248. spacer 15.33|2278983|35|NZ_LN868939|PILER-CR matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 10, identity: 0.714
cccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
gagtcggaccggttgggcgtcgtcctcgaagaggg Protospacer
*. *******.***************.** .
1249. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 10, identity: 0.706
cgcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
ggcgcacgggcgccgacgtcgtcggcccttcgat Protospacer
*** ********** ********* *.*
1250. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 10, identity: 0.706
cgcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
ggcgcacgggcgccgacgtcgtcggtccttcgat Protospacer
*** ********** ********* *.*
1251. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 10, identity: 0.706
cgcgaacgggcgccgccgtcgtcgg-----ggaagaggt CRISPR spacer
ggcgcacgggcgccgacgtcgtcggcccttcgag----- Protospacer
*** ********** ********* **.
1252. spacer 15.39|2279349|34|NZ_LN868939|PILER-CR matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706
cgcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
atccaggtctcgccgccgtcctcggtgaagaggt Protospacer
* *. ********** **** ********
1253. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1254. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1255. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1256. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1257. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1258. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1259. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1260. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1261. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1262. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1263. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1264. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1265. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1266. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1267. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1268. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1269. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1270. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1271. spacer 15.42|2278377|34|NZ_LN868939|CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 10, identity: 0.706
gcatggaccccggccacatgcgcggcttcatagc CRISPR spacer
ccctggacgccgcccacatgcgcggctgggacgt Protospacer
* ***** *** ************** . *.
1272. spacer 15.45|2278560|34|NZ_LN868939|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 10, identity: 0.706
gcggtcaggctggtgttgatctcgctgatctggc CRISPR spacer
tggcgcaggctggcgctgatctcgctgatgttct Protospacer
* ********.*.************* * .
1273. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to HM486077 (Tsukamurella phage TPA2, complete sequence) position: , mismatch: 10, identity: 0.677
gccaaacccaccaccaccaccgcggcgacgc--- CRISPR spacer
---gagttcaccaccaccaccaccgcgccgccga Protospacer
.*...*************.* *** ***
1274. spacer 15.47|2278682|31|NZ_LN868939|CRT matches to NC_015210 (Tsukamurella phage TPA2, complete genome) position: , mismatch: 10, identity: 0.677
gccaaacccaccaccaccaccgcggcgacgc--- CRISPR spacer
---gagttcaccaccaccaccaccgcgccgccga Protospacer
.*...*************.* *** ***
1275. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to MH077578 (Mycobacterium phage DillTech15, complete genome) position: , mismatch: 10, identity: 0.706
ccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca Protospacer
.. *.* **** ******************
1276. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to MT684586 (Mycobacterium phage Gandalph, complete genome) position: , mismatch: 10, identity: 0.706
ccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca Protospacer
.. *.* **** ******************
1277. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 10, identity: 0.706
ccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca Protospacer
.. *.* **** ******************
1278. spacer 15.52|2278984|34|NZ_LN868939|CRT matches to KT281795 (Mycobacterium phage XFactor, complete genome) position: , mismatch: 10, identity: 0.706
ccttcgaccggtcgggcgtcgtcctcgaggacat CRISPR spacer
ttgttgcacggtatggcgtcgtcctcgaggacca Protospacer
.. *.* **** ******************
1279. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP033037 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence) position: , mismatch: 10, identity: 0.706
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
aaaaccgagaaggcgcagtcgcaggtcaagcgga Protospacer
.* ..************* * ******** . *
1280. spacer 16.9|2651527|42|NZ_LN868939|CRT matches to NZ_LN868940 (Nocardia farcinica strain NCTC11134 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.762
ggaggaccaggtgtgggcccaggtggaggaccaggtggggga CRISPR spacer
gggggaccaggtgtgggcccaggtggaggactggtgcaccgg Protospacer
**.****************************..* . *.
1281. spacer 6.7|1457258|32|NZ_LN868939|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.656
accggcacgctgctcgacggctttctgagctg CRISPR spacer
ctcggcgcgctgctcgacggcattcccgagca Protospacer
.****.************** ***. .. ..
1282. spacer 11.3|2140463|32|NZ_LN868939|PILER-CR,CRISPRCasFinder,CRT matches to NC_022753 (Mycobacterium phage Fredward, complete genome) position: , mismatch: 11, identity: 0.656
cccatgacccccaccgaggtcgacgccgcgtg CRISPR spacer
gtgcagacctccaccgaggtcgacaccgatac Protospacer
. ****.**************.***
1283. spacer 12.3|2142562|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_019338 (Arthrobacter sp. J3-37 plasmid pJ337-114, complete sequence) position: , mismatch: 11, identity: 0.656
tgatccgggcgatcctcgacgccctcaccggc CRISPR spacer
cgatcccggcgatcctcgccgccccaggatct Protospacer
.***** *********** *****. . .
1284. spacer 12.7|2142806|32|NZ_LN868939|CRISPRCasFinder,CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 11, identity: 0.656
gagaagctgatcgtcgccgacctcttcacgct CRISPR spacer
ctgaagcggatcgtcgccgatctctctttaga Protospacer
***** ************.****.. ..
1285. spacer 14.1|2163630|34|NZ_LN868939|PILER-CR matches to NC_017543 (Paenibacillus polymyxa M1 plasmid pPPM1a, complete sequence) position: , mismatch: 11, identity: 0.676
cccgcgagatgctggagcggctgatgaagacccg CRISPR spacer
tgattgagctgctggatcggctgatgaagaaagc Protospacer
. .*** ******* *************
1286. spacer 14.8|2164057|34|NZ_LN868939|PILER-CR matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.676
ccgccttcgacccggccgacatgaccgccgcgtc CRISPR spacer
tgcgcctcgacccggccgacgtcaccgccgaacg Protospacer
. *.**************.* ******* ..
1287. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 11, identity: 0.667
ccagccgccgctcatgatcggcgaggaacatca CRISPR spacer
ggagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1288. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to NC_041944 (Arthrobacter phage Preamble, complete genome) position: , mismatch: 11, identity: 0.667
ccagccgccgctcatgatcggcgaggaacatca CRISPR spacer
ggagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1289. spacer 14.39|2163875|33|NZ_LN868939|CRT matches to MH744421 (Arthrobacter phage Moki, complete genome) position: , mismatch: 11, identity: 0.667
ccagccgccgctcatgatcggcgaggaacatca CRISPR spacer
ggagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1290. spacer 15.8|2278682|29|NZ_LN868939|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 11, identity: 0.621
gccaaacccaccaccaccaccgcggcgac--- CRISPR spacer
---cggctcaccacctccaccaccgcggcgag Protospacer
..*.******* *****.* ***.*
1291. spacer 15.10|2278801|32|NZ_LN868939|CRISPRCasFinder matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 11, identity: 0.656
ccgaggtcgattccgcgggcgtcggcgtaggc CRISPR spacer
attgcgtcgataccgcgggcgtctgcgtccag Protospacer
. . ****** *********** **** .
1292. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
cgattcgagacggcgcaggcccaggacatcgcca Protospacer
. ****** ************** ** * .
1293. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
atggtccagcaggcgcaggcccaggtcgaggatc Protospacer
. *** ** *****************.* .
1294. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccggcg Protospacer
.************** **** ****. *
1295. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcgta Protospacer
.* ..************* * ******** .
1296. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcgaa Protospacer
.* ..************* * ******** . .
1297. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
aagaccgagaaggcgcagtcacaggtcaagcgaa Protospacer
.* ..************* * ******** . .
1298. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NC_009669 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT01, complete sequence) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
aagaccgagaaggcgcagtcgcaggtcaagcgca Protospacer
.* ..************* * ******** .
1299. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 11, identity: 0.676
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
cgcgtcgagaaggcgctggccaaggttcccggcg Protospacer
.************** **** ****. *
1300. spacer 15.58|2279350|33|NZ_LN868939|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.667
gcgaacgggcgccgccgtcgtcggggaagaggt CRISPR spacer
cgaaacgggcgcggccgtcgtcggcgatcgccc Protospacer
.********* *********** ** . .
1301. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MK279862 (Arthrobacter phage Lennox, complete genome) position: , mismatch: 12, identity: 0.647
cccagccgccgctcatgatcggcgaggaacatca CRISPR spacer
aggagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1302. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to NC_041944 (Arthrobacter phage Preamble, complete genome) position: , mismatch: 12, identity: 0.647
cccagccgccgctcatgatcggcgaggaacatca CRISPR spacer
aggagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1303. spacer 14.5|2163874|34|NZ_LN868939|PILER-CR matches to MH744421 (Arthrobacter phage Moki, complete genome) position: , mismatch: 12, identity: 0.647
cccagccgccgctcatgatcggcgaggaacatca CRISPR spacer
aggagccgccgctcacgaccggcgaggttttcgt Protospacer
************.**.******** . .
1304. spacer 15.57|2279289|34|NZ_LN868939|CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 12, identity: 0.647
gacgtcgagaaggcgcaggcccaggtcaacttgt CRISPR spacer
acggtcgaccaggcgcaggcccaggtcggtccag Protospacer
. ***** *****************......