Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012370 Moorella thermoacetica strain DSM 2955 chromosome, complete genome 3 crisprs csa3,cas2,cas1,cas4,cas7,cas8c,cas5,cas3,WYL,DinG,cas6,RT 0 3 1 0

Results visualization

1. NZ_CP012370
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012370_1 504007-505769 TypeI I-C,III-B
24 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012370_2 717929-718020 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012370_3 1767087-1769714 Unclear NA
40 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012370_3 3.19|1768288|35|NZ_CP012370|PILER-CR,CRISPRCasFinder,CRT 1768288-1768322 35 NC_015938 Salmonella phage 7-11, complete genome 16459-16493 8 0.771
NZ_CP012370_3 3.27|1768807|35|NZ_CP012370|PILER-CR,CRISPRCasFinder,CRT 1768807-1768841 35 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 353801-353835 8 0.771
NZ_CP012370_1 1.18|505267|35|NZ_CP012370|CRT,PILER-CR,CRISPRCasFinder 505267-505301 35 NZ_CP016024 Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence 69648-69682 10 0.714

1. spacer 3.19|1768288|35|NZ_CP012370|PILER-CR,CRISPRCasFinder,CRT matches to NC_015938 (Salmonella phage 7-11, complete genome) position: , mismatch: 8, identity: 0.771

taaaatgcttgatgcggatttaattgatgtttata	CRISPR spacer
tggacatattgatgcggctttaattgatgttaata	Protospacer
*..*    ********* ************* ***

2. spacer 3.27|1768807|35|NZ_CP012370|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.771

tgctacgtccagcttcaatatccgctataaaagaa	CRISPR spacer
agtcaaagccagcttcaatatccgctatataagat	Protospacer
 *..* . ********************* **** 

3. spacer 1.18|505267|35|NZ_CP012370|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 10, identity: 0.714

tttcggcttcggggccttatattccttgccatcca	CRISPR spacer
cgccaacttcgtggcctgatattccttgccatttg	Protospacer
. .*..***** ***** **************...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2130403 : 2139286 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage