Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012517 Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence 2 crisprs DEDDh,DinG,csa3,cas3,WYL 5 14 8 0
NZ_CP012518 Burkholderia pseudomallei strain vgh16W chromosome 2, complete sequence 3 crisprs cas3,DinG,csa3 0 0 5 0

Results visualization

1. NZ_CP012517
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012517_1 2193931-2194290 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012517_2 3998391-3998800 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012517_1 1.4|2194081|18|NZ_CP012517|CRT 2194081-2194098 18 NZ_CP012517.1 2194417-2194434 1 0.944
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP012517.1 2194333-2194356 1 0.958
NZ_CP012517_1 1.8|2194249|24|NZ_CP012517|CRT 2194249-2194272 24 NZ_CP012517.1 2194375-2194398 1 0.958
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP012517.1 2194285-2194314 2 0.933
NZ_CP012517_1 1.6|2194159|30|NZ_CP012517|CRT 2194159-2194188 30 NZ_CP012517.1 2193907-2193936 2 0.933
NZ_CP012517_1 1.6|2194159|30|NZ_CP012517|CRT 2194159-2194188 30 NZ_CP012517.1 2194411-2194440 2 0.933
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP012517.1 2194543-2194566 2 0.917

1. spacer 1.4|2194081|18|NZ_CP012517|CRT matches to position: 2194417-2194434, mismatch: 1, identity: 0.944

tcgccgtgctgttatcgc	CRISPR spacer
tcgccgtgctgttctcgc	Protospacer
************* ****

2. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to position: 2194333-2194356, mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttatcacccgacg	Protospacer
****************.*******

3. spacer 1.8|2194249|24|NZ_CP012517|CRT matches to position: 2194375-2194398, mismatch: 1, identity: 0.958

tggctgtgctgttgctgcccgatg	CRISPR spacer
tggccgtgctgttgctgcccgatg	Protospacer
****.*******************

4. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to position: 2194285-2194314, mismatch: 2, identity: 0.933

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
tgcctgtcgccgtgctgttctcaccggtcg	Protospacer
**********************.** ****

5. spacer 1.6|2194159|30|NZ_CP012517|CRT matches to position: 2193907-2193936, mismatch: 2, identity: 0.933

tacccgtcgccgtgctgttctcaccggtcg	CRISPR spacer
tacccgtcgccgtgctgttttcacccgtcg	Protospacer
*******************.***** ****

6. spacer 1.6|2194159|30|NZ_CP012517|CRT matches to position: 2194411-2194440, mismatch: 2, identity: 0.933

tacccgtcgccgtgctgttctcaccggtcg	CRISPR spacer
tacccgtcgccgtgctgttctcgccgctcg	Protospacer
**********************.*** ***

7. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to position: 2194543-2194566, mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcacccgacg	Protospacer
*************.**.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 110895-110918 1 0.958
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111021-111044 1 0.958
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111147-111170 1 0.958
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111273-111296 1 0.958
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111399-111422 1 0.958
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111525-111548 1 0.958
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111651-111674 1 0.958
NZ_CP012517_1 1.1|2193949|24|NZ_CP012517|CRT 2193949-2193972 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 110901-110924 2 0.917
NZ_CP012517_1 1.1|2193949|24|NZ_CP012517|CRT 2193949-2193972 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111153-111176 2 0.917
NZ_CP012517_1 1.1|2193949|24|NZ_CP012517|CRT 2193949-2193972 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111531-111554 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 110937-110960 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111189-111212 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111567-111590 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_KX009507 Escherichia coli strain 06K2206 plasmid LM6771, complete sequence 85046-85069 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_019368 Enterobacter cloacae plasmid pEl1573, complete sequence 40319-40342 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_KM877517 Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence 122208-122231 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_KP294351 Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence 63591-63614 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_KU315015 Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence 84838-84861 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP026156 Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence 47251-47274 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_004464 Citrobacter freundii plasmid pCTX-M3, complete sequence 43332-43355 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042501 Enterobacter sp. E76 plasmid pE76_002, complete sequence 84995-85018 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP048339 Escherichia coli strain 142 plasmid p142_B, complete sequence 47727-47750 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042509 Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence 70464-70487 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_LT994838 Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence 30710-30733 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042514 Serratia marcescens strain E28 plasmid pE28_002, complete sequence 76185-76208 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_LT985387 Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI 47378-47401 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP045511 Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid p55k, complete sequence 43361-43384 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC508263 Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence 40061-40084 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP017288 Klebsiella variicola strain GJ3 plasmid pKPGJ-3d, complete sequence 26211-26234 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_019063 Escherichia coli plasmid pNDM-HK, complete sequence 77795-77818 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 MG516907 Klebsiella aerogenes plasmid pEa1631, complete sequence 40319-40342 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042532 Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence 76185-76208 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP017282 Klebsiella variicola strain GJ1 plasmid pKPGJ-1c, complete sequence 22600-22623 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_LT994833 Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence 29648-29671 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP031235 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence 19903-19926 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 KP294350 Uncultured bacterium plasmid pARM26, complete sequence 75700-75723 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC536683 Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence 69249-69272 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP048418 Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence 44922-44945 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP053283 Escherichia coli strain SCU-308 plasmid pSCU-308-2, complete sequence 56655-56678 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042574 Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence 74858-74881 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042542 Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence 76185-76208 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP014298 Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence 43229-43252 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042580 Enterobacter kobei strain C16 plasmid pC16_002, complete sequence 70464-70487 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP026497 Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence 43597-43620 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 12805-12828 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP031216 Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence 26896-26919 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_011641 Klebsiella pneumoniae plasmid pCTXM360, complete sequence 13611-13634 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_019344 Serratia marcescens plasmid R830b, complete sequence 56260-56283 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042526 Citrobacter freundii strain E11 plasmid pE11_002, complete sequence 76185-76208 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP031322 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence 4606-4629 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_LT985264 Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence 67923-67946 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_LT985241 Escherichia coli strain 721 plasmid RCS40_p, complete sequence 69824-69847 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC505604 Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence 40061-40084 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC508722 Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence 40061-40084 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_019889 Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence 26449-26472 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 MT193824 Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence 20807-20830 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_MF156266 Escherichia coli strain 24-S11 plasmid pCESC2, complete sequence 61915-61938 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042568 Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence 76185-76208 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_KM406490 Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence 17006-17029 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_KM406489 Serratia marcescens strain R471 plasmid R471, complete sequence 73764-73787 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP035217 Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence 66591-66614 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556214 Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556215 Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556216 Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556217 Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556218 Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556219 Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556220 Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556221 Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 LC556222 Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence 16559-16582 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_024997 Klebsiella oxytoca plasmid pACM1, complete sequence 53157-53180 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 50265-50288 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP017853 Klebsiella variicola strain GJ2 plasmid pKPGJ-2d, complete sequence 43243-43266 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 KU159086 Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence 13435-13458 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP032193 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence 54796-54819 2 0.917
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NZ_CP042490 Enterobacter hormaechei strain C15 plasmid pC15_002 13434-13457 2 0.917
NZ_CP012517_1 1.1|2193949|24|NZ_CP012517|CRT 2193949-2193972 24 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 870686-870709 3 0.875
NZ_CP012517_1 1.2|2193991|24|NZ_CP012517|CRT 2193991-2194014 24 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 164149-164172 3 0.875
NZ_CP012517_1 1.5|2194117|24|NZ_CP012517|CRT 2194117-2194140 24 NZ_CP030363 Salinibacter ruber strain SP73 plasmid pSR118, complete sequence 43717-43740 3 0.875
NZ_CP012517_1 1.7|2194207|24|NZ_CP012517|CRT 2194207-2194230 24 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 600946-600969 3 0.875
NZ_CP012517_1 1.8|2194249|24|NZ_CP012517|CRT 2194249-2194272 24 MH651171 Mycobacterium phage Collard, complete genome 24971-24994 3 0.875
NZ_CP012517_1 1.8|2194249|24|NZ_CP012517|CRT 2194249-2194272 24 NC_028947 Mycobacterium phage Kratio, complete genome 24645-24668 3 0.875
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 110895-110924 5 0.833
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111147-111176 5 0.833
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 111525-111554 5 0.833
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 274916-274945 5 0.833
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279887 Mycobacterium phage Timmi, complete genome 40471-40497 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH651175 Mycobacterium phage Gophee, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 GQ303264 Mycobacterium phage Puhltonio, complete genome 40765-40791 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 GU247134 Mycobacterium phage Scoot17C, complete genome 40898-40924 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX683293 Mycobacterium phage Daffy, complete genome 40480-40506 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279888 Mycobacterium phage TomBombadil, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF957056 Mycobacterium phage Thora, complete genome 40771-40797 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT316463 Mycobacterium phage Slatt, complete genome 40775-40801 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX576645 Mycobacterium phage Derpp, complete genome 40325-40351 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH651184 Mycobacterium phage Phareon, complete genome 40464-40490 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN006063 Mycobacterium phage Serendipity, complete genome 40779-40805 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH779500 Mycobacterium phage Crownjwl, complete genome 40543-40569 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH230875 Mycobacterium phage CheetO, complete genome 40766-40792 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG962365 Mycobacterium phage DoesntMatter, complete genome 40752-40778 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279882 Mycobacterium phage Sophia, complete genome 40470-40496 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX670813 Mycobacterium phage MitKao, complete genome 40468-40494 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH576970 Mycobacterium phage DonSanchon, complete genome 40462-40488 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279866 Mycobacterium phage MRabcd, complete genome 40461-40487 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH513973 Mycobacterium phage Kwksand96, complete genome 40330-40356 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN945899 Mycobacterium phage Skippy, complete genome 40749-40775 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279908 Mycobacterium phage Roliet, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_023727 Mycobacterium phage Vista, complete genome 40769-40795 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT897909 Mycobacterium phage Maru, complete genome 40413-40439 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH727555 Mycobacterium phage Mulan, complete genome 40624-40650 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_027985 Mycobacterium phage UncleHowie, complete genome 40468-40494 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN698990 Mycobacterium phage IsaacEli, complete genome 40907-40933 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KY965066 Mycobacterium phage BlackStallion, complete genome 40902-40928 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN703415 Mycobacterium phage Mcshane, complete genome 40462-40488 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX592589 Mycobacterium phage Iridoclysis, complete genome 40748-40774 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH051251 Mycobacterium phage DuchessDung, complete genome 39751-39777 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX576646 Mycobacterium phage TyrionL, complete genome 40325-40351 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279871 Mycobacterium phage Plmatters, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279883 Mycobacterium phage Struggle, complete genome 40317-40343 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 40771-40797 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH371107 Mycobacterium phage Doddsville, complete genome 40479-40505 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_028942 Mycobacterium phage Phipps, complete sequence 40744-40770 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KJ567044 Mycobacterium phage EmpTee, complete genome 40765-40791 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279881 Mycobacterium phage Solosis, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG944223 Mycobacterium phage Trypo, complete genome 40900-40926 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT897902 Mycobacterium phage Boehler, complete genome 40772-40798 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279855 Mycobacterium phage Haleema, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JX649096 Mycobacterium phage Serpentine, complete genome 40766-40792 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK494104 Mycobacterium phage HenryJackson, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG944225 Mycobacterium phage Xavier, complete genome 40473-40499 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JX649099 Mycobacterium phage Gyarad, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH450116 Mycobacterium phage Buckeye, complete genome 40786-40812 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN638753 Mycobacterium phage Morgushi, complete genome 40469-40495 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG757158 Mycobacterium phage HighStump, complete genome 40603-40629 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112539 Mycobacterium phage Dione, complete genome 40459-40485 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279873 Mycobacterium phage QueenBeane, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF668276 Mycobacterium phage Lulumae, complete genome 40455-40481 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT897903 Mycobacterium phage DirtJuice, complete genome 40749-40775 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH513980 Mycobacterium phage Roy17, complete genome 40455-40481 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT316460 Mycobacterium phage Kimbrough, complete genome 40480-40506 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF937097 Mycobacterium phage Hertubise, complete genome 40776-40802 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH230874 Mycobacterium phage Banjo, complete genome 40448-40474 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH651186 Mycobacterium phage Podrick, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG962362 Mycobacterium phage AltPhacts, complete genome 40744-40770 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF704103 Mycobacterium phage Vortex, complete sequence 40466-40492 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 FJ174694 Mycobacterium phage Chah, complete genome 40916-40942 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH051264 Mycobacterium phage Cobra, complete genome 40767-40793 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112536 Mycobacterium phage Cannibal, complete genome 40738-40764 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX578071 Mycobacterium phage Mana, complete genome 40470-40496 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919539 Mycobacterium phage Virapocalypse, complete genome 40759-40785 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KC661274 Mycobacterium phage SDcharge11, complete genome 40742-40768 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KJ194579 Mycobacterium phage Swish, complete genome 40890-40916 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH371114 Mycobacterium phage Childish, complete genome 40486-40512 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279852 Mycobacterium phage Fringe, complete genome 40886-40912 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KY385382 Mycobacterium phage ImtiyazSitla, complete genome 40451-40477 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN699010 Mycobacterium phage TallGrassMM, complete genome 40385-40411 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG757159 Mycobacterium phage JangoPhett, complete genome 40759-40785 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279891 Mycobacterium phage Wallhey, complete genome 40329-40355 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919503 Mycobacterium phage Dingo, complete genome 40750-40776 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KY676783 Mycobacterium phage Chorkpop, complete genome 40482-40508 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112527 Mycobacterium phage Altwerkus, complete genome 40450-40476 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JX649100 Mycobacterium phage Alex, complete genome 40792-40818 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_028691 Mycobacterium phage Apizium, complete genome 40650-40676 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH371125 Mycobacterium phage Morty, complete genome 40907-40933 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF937109 Mycobacterium phage Yoshand, complete genome 40903-40929 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279878 Mycobacterium phage Samaymay, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 40892-40918 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112551 Mycobacterium phage Riggan, complete genome 40751-40777 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN945903 Mycobacterium phage Jiminy, complete genome 40319-40345 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KM363597 Mycobacteriophage Zonia, complete genome 40780-40806 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KF713485 Mycobacterium phage Suffolk, complete genome 40766-40792 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG770212 Mycobacterium phage Haimas, complete genome 40762-40788 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279861 Mycobacterium phage Legolas, complete genome 40500-40526 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279843 Mycobacterium phage CamL, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279846 Mycobacterium phage Cosmolli16, complete genome 40474-40500 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KM408320 Mycobacterium phage Lasso, complete genome 40730-40756 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KR029086 Mycobacterium phage PDRPv, complete genome 40479-40505 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KY385380 Mycobacterium phage Ashraf, complete genome 40451-40477 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH825705 Mycobacterium phage Mesh1, complete genome 40777-40803 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT952849 Mycobacterium phage Windsor, complete genome 40465-40491 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH576954 Mycobacterium phage HSavage, complete genome 40768-40794 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112555 Mycobacterium phage Zelda, complete genome 40810-40836 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_028803 Mycobacterium phage OSmaximus, complete genome 40940-40966 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279904 Mycobacterium phage RedMaple, complete genome 40906-40932 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KR029087 Mycobacterium phage PDRPxv, complete genome 40540-40566 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN699009 Mycobacterium phage ThreeOh3D2, complete genome 40904-40930 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_005259 Mycobacterium phage PG1, complete genome 40909-40935 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112552 Mycobacterium phage Spartan300, complete genome 40761-40787 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX702319 Mycobacterium phage Pinkman, complete genome 40323-40349 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919523 Mycobacterium phage Mikota, complete genome 40748-40774 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KU867907 Mycobacterium phage Potter, complete genome 40479-40505 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH590588 Mycobacterium phage Vaticameos, complete genome 38450-38476 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279885 Mycobacterium phage Surely, complete genome 40772-40798 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279870 Mycobacterium phage Omniscient, complete genome 40775-40801 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN638752 Mycobacterium phage Murdoc, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG962375 Mycobacterium phage ProfessorX, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG925348 Mycobacterium phage Megatron, complete genome 40898-40924 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH077582 Mycobacterium phage Olive, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF155947 Mycobacterium phage LemonSlice, complete genome 40467-40493 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KP027209 Mycobacterium phage Sigman, complete genome 40889-40915 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH450122 Mycobacterium phage KingTut, complete genome 36143-36169 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279859 Mycobacterium phage Kwadwo, complete genome 40455-40481 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112546 Mycobacterium phage LuckyMarjie, complete genome 40470-40496 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX620786 Mycobacterium phage Lego3393, complete genome 40910-40936 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112544 Mycobacterium phage Keitherie, complete genome 40819-40845 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KP027197 Mycobacterium phage FluffyNinja, complete genome 40903-40929 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH651177 Mycobacterium phage KlimbOn, complete genome 40757-40783 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279877 Mycobacterium phage Roscoe, complete genome 41001-41027 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN698989 Mycobacterium phage JacAttac, complete genome 40889-40915 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH479918 Mycobacterium phage Labeouficaum, complete genome 40325-40351 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112553 Mycobacterium Phage Squiggle, complete genome 40485-40511 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_028907 Mycobacterium phage Kikipoo, complete genome 40907-40933 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279850 Mycobacterium phage Durga, complete genome 40917-40943 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279897 Mycobacterium phage Bishoperium, complete genome 40463-40489 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN585965 Mycobacterium phage Duggie, complete genome 40481-40507 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT310868 Mycobacterium phage Telesworld, complete genome 40464-40490 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279865 Mycobacterium phage Mecca, complete genome 40468-40494 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KC576784 Mycobacterium phage ShiVal, complete genome 40765-40791 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH479916 Mycobacterium phage GeneCoco, complete genome 40773-40799 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN444868 Mycobacterium phage Prickles, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KY385383 Mycobacterium phage Maskar, complete genome 40451-40477 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH371117 Mycobacterium phage Kahve, complete genome 40473-40499 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH399773 Mycobacterium phage Craff, complete genome 40902-40928 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 GU247133 Mycobacterium phage Fang, complete genome 40910-40936 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_008197 Mycobacterium phage Orion, complete genome 40896-40922 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH479921 Mycobacterium phage Placalicious, complete genome 40461-40487 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT897901 Mycobacterium phage Adriana, complete genome 40892-40918 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN369744 Mycobacterium phage Beaglebox, complete genome 40469-40495 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919530 Mycobacterium phage Sheila, complete genome 40804-40830 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG925356 Mycobacterium phage OliverWalter, complete genome 40778-40804 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JX649098 Mycobacterium phage Nacho, complete genome 40901-40927 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT889369 Mycobacterium phage Inchworm, complete genome 40889-40915 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KP027208 Mycobacterium phage Pipsqueak, complete genome 40768-40794 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919519 Mycobacterium phage Longacauda, complete genome 40463-40489 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF704109 Mycobacterium phage Oosterbaan, complete sequence 40763-40789 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX369585 Mycobacterium phage PhatCats2014, complete genome 40913-40939 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK310139 Mycobacterium phage Emiris, complete genome 40885-40911 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KJ194580 Mycobacterium phage Badfish, complete genome 40917-40943 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KX576647 Mycobacterium phage CharlieGBrown, complete genome 40336-40362 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN369738 Mycobacterium phage Hocus, complete genome 40465-40491 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279889 Mycobacterium phage Valjean, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH399775 Mycobacterium phage Gareth, complete genome 40458-40484 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279894 Mycobacterium phage YouGoGlencoco, complete genome 40763-40789 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279895 Mycobacterium phage Zaider, complete genome 40993-41019 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MN585967 Mycobacterium phage Kloppinator, complete genome 41182-41208 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK279858 Mycobacterium phage JakeO, complete genome 40484-40510 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_028681 Mycobacterium phage Pops, complete genome 40779-40805 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH744417 Mycobacterium phage Grand2040, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JX649097 Mycobacterium phage Piglet, complete genome 40874-40900 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MG925350 Mycobacterium phage Mosaic, complete genome 40462-40488 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH479914 Mycobacterium phage FugateOSU, complete genome 40464-40490 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH825702 Mycobacterium phage Hamish, complete genome 40754-40780 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF704091 Mycobacterium phage ABU, complete sequence 40894-40920 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919528 Mycobacterium phage Phunky, complete genome 40761-40787 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_028690 Mycobacterium phage Eremos, complete genome 40758-40784 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 40751-40777 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JN192463 Mycobacterium phage Oline, complete genome 40329-40355 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NC_021310 Mycobacterium phage Newman, complete genome 40760-40786 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MK112542 Mycobacterium phage Jillium, complete genome 40478-40504 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MT310867 Mycobacterium phage Chaelin, complete genome 40461-40487 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KJ194583 Mycobacterium phage Numberten, complete genome 40767-40793 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH590594 Mycobacterium phage PinheadLarry, complete genome 40474-40500 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 KJ174157 Mycobacterium phage Soto, complete genome 40776-40802 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH399780 Mycobacterium phage Mutante, complete genome 40474-40500 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 JF704099 Mycobacterium phage KLucky39, complete sequence 40763-40789 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MH779516 Mycobacterium phage Waterdiva, complete genome 40761-40787 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 MF919507 Mycobacterium phage Horchata, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.2|3998475|27|NZ_CP012517|CRT 3998475-3998501 27 NZ_CP045374 Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence 161364-161390 5 0.815
NZ_CP012517_2 2.3|3998522|26|NZ_CP012517|CRT 3998522-3998547 26 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 216447-216472 5 0.808
NZ_CP012517_2 2.3|3998522|26|NZ_CP012517|CRT 3998522-3998547 26 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 459201-459226 5 0.808
NZ_CP012517_2 2.3|3998522|26|NZ_CP012517|CRT 3998522-3998547 26 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 79159-79184 5 0.808
NZ_CP012517_2 2.3|3998522|26|NZ_CP012517|CRT 3998522-3998547 26 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 89074-89099 5 0.808
NZ_CP012517_2 2.4|3998568|27|NZ_CP012517|CRT 3998568-3998594 27 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 119428-119454 5 0.815
NZ_CP012517_2 2.5|3998615|26|NZ_CP012517|CRT 3998615-3998640 26 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 216447-216472 5 0.808
NZ_CP012517_2 2.5|3998615|26|NZ_CP012517|CRT 3998615-3998640 26 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 459201-459226 5 0.808
NZ_CP012517_2 2.5|3998615|26|NZ_CP012517|CRT 3998615-3998640 26 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 79159-79184 5 0.808
NZ_CP012517_2 2.5|3998615|26|NZ_CP012517|CRT 3998615-3998640 26 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 89074-89099 5 0.808
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279887 Mycobacterium phage Timmi, complete genome 40471-40497 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH651175 Mycobacterium phage Gophee, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 GQ303264 Mycobacterium phage Puhltonio, complete genome 40765-40791 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 GU247134 Mycobacterium phage Scoot17C, complete genome 40898-40924 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX683293 Mycobacterium phage Daffy, complete genome 40480-40506 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279888 Mycobacterium phage TomBombadil, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF957056 Mycobacterium phage Thora, complete genome 40771-40797 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT316463 Mycobacterium phage Slatt, complete genome 40775-40801 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX576645 Mycobacterium phage Derpp, complete genome 40325-40351 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH651184 Mycobacterium phage Phareon, complete genome 40464-40490 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN006063 Mycobacterium phage Serendipity, complete genome 40779-40805 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH779500 Mycobacterium phage Crownjwl, complete genome 40543-40569 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH230875 Mycobacterium phage CheetO, complete genome 40766-40792 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG962365 Mycobacterium phage DoesntMatter, complete genome 40752-40778 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279882 Mycobacterium phage Sophia, complete genome 40470-40496 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX670813 Mycobacterium phage MitKao, complete genome 40468-40494 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH576970 Mycobacterium phage DonSanchon, complete genome 40462-40488 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279866 Mycobacterium phage MRabcd, complete genome 40461-40487 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH513973 Mycobacterium phage Kwksand96, complete genome 40330-40356 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN945899 Mycobacterium phage Skippy, complete genome 40749-40775 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279908 Mycobacterium phage Roliet, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_023727 Mycobacterium phage Vista, complete genome 40769-40795 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT897909 Mycobacterium phage Maru, complete genome 40413-40439 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH727555 Mycobacterium phage Mulan, complete genome 40624-40650 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_027985 Mycobacterium phage UncleHowie, complete genome 40468-40494 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN698990 Mycobacterium phage IsaacEli, complete genome 40907-40933 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KY965066 Mycobacterium phage BlackStallion, complete genome 40902-40928 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN703415 Mycobacterium phage Mcshane, complete genome 40462-40488 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX592589 Mycobacterium phage Iridoclysis, complete genome 40748-40774 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH051251 Mycobacterium phage DuchessDung, complete genome 39751-39777 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX576646 Mycobacterium phage TyrionL, complete genome 40325-40351 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279871 Mycobacterium phage Plmatters, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279883 Mycobacterium phage Struggle, complete genome 40317-40343 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 40771-40797 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH371107 Mycobacterium phage Doddsville, complete genome 40479-40505 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_028942 Mycobacterium phage Phipps, complete sequence 40744-40770 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KJ567044 Mycobacterium phage EmpTee, complete genome 40765-40791 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279881 Mycobacterium phage Solosis, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG944223 Mycobacterium phage Trypo, complete genome 40900-40926 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT897902 Mycobacterium phage Boehler, complete genome 40772-40798 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279855 Mycobacterium phage Haleema, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JX649096 Mycobacterium phage Serpentine, complete genome 40766-40792 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK494104 Mycobacterium phage HenryJackson, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG944225 Mycobacterium phage Xavier, complete genome 40473-40499 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JX649099 Mycobacterium phage Gyarad, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH450116 Mycobacterium phage Buckeye, complete genome 40786-40812 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN638753 Mycobacterium phage Morgushi, complete genome 40469-40495 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG757158 Mycobacterium phage HighStump, complete genome 40603-40629 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112539 Mycobacterium phage Dione, complete genome 40459-40485 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279873 Mycobacterium phage QueenBeane, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF668276 Mycobacterium phage Lulumae, complete genome 40455-40481 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT897903 Mycobacterium phage DirtJuice, complete genome 40749-40775 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH513980 Mycobacterium phage Roy17, complete genome 40455-40481 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT316460 Mycobacterium phage Kimbrough, complete genome 40480-40506 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF937097 Mycobacterium phage Hertubise, complete genome 40776-40802 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH230874 Mycobacterium phage Banjo, complete genome 40448-40474 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH651186 Mycobacterium phage Podrick, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG962362 Mycobacterium phage AltPhacts, complete genome 40744-40770 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF704103 Mycobacterium phage Vortex, complete sequence 40466-40492 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 FJ174694 Mycobacterium phage Chah, complete genome 40916-40942 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH051264 Mycobacterium phage Cobra, complete genome 40767-40793 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112536 Mycobacterium phage Cannibal, complete genome 40738-40764 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX578071 Mycobacterium phage Mana, complete genome 40470-40496 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919539 Mycobacterium phage Virapocalypse, complete genome 40759-40785 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KC661274 Mycobacterium phage SDcharge11, complete genome 40742-40768 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KJ194579 Mycobacterium phage Swish, complete genome 40890-40916 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH371114 Mycobacterium phage Childish, complete genome 40486-40512 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279852 Mycobacterium phage Fringe, complete genome 40886-40912 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KY385382 Mycobacterium phage ImtiyazSitla, complete genome 40451-40477 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN699010 Mycobacterium phage TallGrassMM, complete genome 40385-40411 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG757159 Mycobacterium phage JangoPhett, complete genome 40759-40785 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279891 Mycobacterium phage Wallhey, complete genome 40329-40355 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919503 Mycobacterium phage Dingo, complete genome 40750-40776 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KY676783 Mycobacterium phage Chorkpop, complete genome 40482-40508 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112527 Mycobacterium phage Altwerkus, complete genome 40450-40476 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JX649100 Mycobacterium phage Alex, complete genome 40792-40818 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_028691 Mycobacterium phage Apizium, complete genome 40650-40676 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH371125 Mycobacterium phage Morty, complete genome 40907-40933 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF937109 Mycobacterium phage Yoshand, complete genome 40903-40929 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279878 Mycobacterium phage Samaymay, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 40892-40918 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112551 Mycobacterium phage Riggan, complete genome 40751-40777 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN945903 Mycobacterium phage Jiminy, complete genome 40319-40345 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KM363597 Mycobacteriophage Zonia, complete genome 40780-40806 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KF713485 Mycobacterium phage Suffolk, complete genome 40766-40792 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG770212 Mycobacterium phage Haimas, complete genome 40762-40788 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279861 Mycobacterium phage Legolas, complete genome 40500-40526 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279843 Mycobacterium phage CamL, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279846 Mycobacterium phage Cosmolli16, complete genome 40474-40500 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KM408320 Mycobacterium phage Lasso, complete genome 40730-40756 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KR029086 Mycobacterium phage PDRPv, complete genome 40479-40505 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KY385380 Mycobacterium phage Ashraf, complete genome 40451-40477 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH825705 Mycobacterium phage Mesh1, complete genome 40777-40803 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT952849 Mycobacterium phage Windsor, complete genome 40465-40491 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH576954 Mycobacterium phage HSavage, complete genome 40768-40794 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112555 Mycobacterium phage Zelda, complete genome 40810-40836 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_028803 Mycobacterium phage OSmaximus, complete genome 40940-40966 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279904 Mycobacterium phage RedMaple, complete genome 40906-40932 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KR029087 Mycobacterium phage PDRPxv, complete genome 40540-40566 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN699009 Mycobacterium phage ThreeOh3D2, complete genome 40904-40930 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_005259 Mycobacterium phage PG1, complete genome 40909-40935 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112552 Mycobacterium phage Spartan300, complete genome 40761-40787 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX702319 Mycobacterium phage Pinkman, complete genome 40323-40349 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919523 Mycobacterium phage Mikota, complete genome 40748-40774 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KU867907 Mycobacterium phage Potter, complete genome 40479-40505 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH590588 Mycobacterium phage Vaticameos, complete genome 38450-38476 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279885 Mycobacterium phage Surely, complete genome 40772-40798 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279870 Mycobacterium phage Omniscient, complete genome 40775-40801 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN638752 Mycobacterium phage Murdoc, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG962375 Mycobacterium phage ProfessorX, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG925348 Mycobacterium phage Megatron, complete genome 40898-40924 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH077582 Mycobacterium phage Olive, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF155947 Mycobacterium phage LemonSlice, complete genome 40467-40493 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KP027209 Mycobacterium phage Sigman, complete genome 40889-40915 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH450122 Mycobacterium phage KingTut, complete genome 36143-36169 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279859 Mycobacterium phage Kwadwo, complete genome 40455-40481 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112546 Mycobacterium phage LuckyMarjie, complete genome 40470-40496 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX620786 Mycobacterium phage Lego3393, complete genome 40910-40936 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112544 Mycobacterium phage Keitherie, complete genome 40819-40845 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KP027197 Mycobacterium phage FluffyNinja, complete genome 40903-40929 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH651177 Mycobacterium phage KlimbOn, complete genome 40757-40783 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279877 Mycobacterium phage Roscoe, complete genome 41001-41027 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN698989 Mycobacterium phage JacAttac, complete genome 40889-40915 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH479918 Mycobacterium phage Labeouficaum, complete genome 40325-40351 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112553 Mycobacterium Phage Squiggle, complete genome 40485-40511 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_028907 Mycobacterium phage Kikipoo, complete genome 40907-40933 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279850 Mycobacterium phage Durga, complete genome 40917-40943 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279897 Mycobacterium phage Bishoperium, complete genome 40463-40489 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN585965 Mycobacterium phage Duggie, complete genome 40481-40507 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT310868 Mycobacterium phage Telesworld, complete genome 40464-40490 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279865 Mycobacterium phage Mecca, complete genome 40468-40494 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KC576784 Mycobacterium phage ShiVal, complete genome 40765-40791 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH479916 Mycobacterium phage GeneCoco, complete genome 40773-40799 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN444868 Mycobacterium phage Prickles, complete genome 40755-40781 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KY385383 Mycobacterium phage Maskar, complete genome 40451-40477 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH371117 Mycobacterium phage Kahve, complete genome 40473-40499 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH399773 Mycobacterium phage Craff, complete genome 40902-40928 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 GU247133 Mycobacterium phage Fang, complete genome 40910-40936 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_008197 Mycobacterium phage Orion, complete genome 40896-40922 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH479921 Mycobacterium phage Placalicious, complete genome 40461-40487 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT897901 Mycobacterium phage Adriana, complete genome 40892-40918 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN369744 Mycobacterium phage Beaglebox, complete genome 40469-40495 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919530 Mycobacterium phage Sheila, complete genome 40804-40830 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG925356 Mycobacterium phage OliverWalter, complete genome 40778-40804 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JX649098 Mycobacterium phage Nacho, complete genome 40901-40927 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT889369 Mycobacterium phage Inchworm, complete genome 40889-40915 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KP027208 Mycobacterium phage Pipsqueak, complete genome 40768-40794 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919519 Mycobacterium phage Longacauda, complete genome 40463-40489 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF704109 Mycobacterium phage Oosterbaan, complete sequence 40763-40789 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX369585 Mycobacterium phage PhatCats2014, complete genome 40913-40939 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK310139 Mycobacterium phage Emiris, complete genome 40885-40911 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KJ194580 Mycobacterium phage Badfish, complete genome 40917-40943 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KX576647 Mycobacterium phage CharlieGBrown, complete genome 40336-40362 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN369738 Mycobacterium phage Hocus, complete genome 40465-40491 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279889 Mycobacterium phage Valjean, complete genome 40764-40790 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH399775 Mycobacterium phage Gareth, complete genome 40458-40484 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279894 Mycobacterium phage YouGoGlencoco, complete genome 40763-40789 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279895 Mycobacterium phage Zaider, complete genome 40993-41019 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MN585967 Mycobacterium phage Kloppinator, complete genome 41182-41208 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK279858 Mycobacterium phage JakeO, complete genome 40484-40510 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_028681 Mycobacterium phage Pops, complete genome 40779-40805 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH744417 Mycobacterium phage Grand2040, complete genome 40476-40502 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JX649097 Mycobacterium phage Piglet, complete genome 40874-40900 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MG925350 Mycobacterium phage Mosaic, complete genome 40462-40488 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH479914 Mycobacterium phage FugateOSU, complete genome 40464-40490 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH825702 Mycobacterium phage Hamish, complete genome 40754-40780 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF704091 Mycobacterium phage ABU, complete sequence 40894-40920 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919528 Mycobacterium phage Phunky, complete genome 40761-40787 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_028690 Mycobacterium phage Eremos, complete genome 40758-40784 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 40751-40777 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JN192463 Mycobacterium phage Oline, complete genome 40329-40355 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NC_021310 Mycobacterium phage Newman, complete genome 40760-40786 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MK112542 Mycobacterium phage Jillium, complete genome 40478-40504 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MT310867 Mycobacterium phage Chaelin, complete genome 40461-40487 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KJ194583 Mycobacterium phage Numberten, complete genome 40767-40793 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH590594 Mycobacterium phage PinheadLarry, complete genome 40474-40500 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 KJ174157 Mycobacterium phage Soto, complete genome 40776-40802 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH399780 Mycobacterium phage Mutante, complete genome 40474-40500 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 JF704099 Mycobacterium phage KLucky39, complete sequence 40763-40789 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MH779516 Mycobacterium phage Waterdiva, complete genome 40761-40787 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 MF919507 Mycobacterium phage Horchata, complete genome 40756-40782 5 0.815
NZ_CP012517_2 2.6|3998661|27|NZ_CP012517|CRT 3998661-3998687 27 NZ_CP045374 Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence 161364-161390 5 0.815
NZ_CP012517_2 2.7|3998708|26|NZ_CP012517|CRT 3998708-3998733 26 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 216447-216472 5 0.808
NZ_CP012517_2 2.7|3998708|26|NZ_CP012517|CRT 3998708-3998733 26 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 459201-459226 5 0.808
NZ_CP012517_2 2.7|3998708|26|NZ_CP012517|CRT 3998708-3998733 26 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 79159-79184 5 0.808
NZ_CP012517_2 2.7|3998708|26|NZ_CP012517|CRT 3998708-3998733 26 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 89074-89099 5 0.808
NZ_CP012517_2 2.8|3998754|27|NZ_CP012517|CRT 3998754-3998780 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 239783-239809 5 0.815
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 410263-410292 6 0.8
NZ_CP012517_2 2.3|3998522|26|NZ_CP012517|CRT 3998522-3998547 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2977319-2977344 6 0.769
NZ_CP012517_2 2.5|3998615|26|NZ_CP012517|CRT 3998615-3998640 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2977319-2977344 6 0.769
NZ_CP012517_2 2.7|3998708|26|NZ_CP012517|CRT 3998708-3998733 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2977319-2977344 6 0.769
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 428249-428278 7 0.767
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 217565-217594 7 0.767
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1082741-1082770 7 0.767
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 600946-600975 8 0.733
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 706630-706659 8 0.733
NZ_CP012517_1 1.6|2194159|30|NZ_CP012517|CRT 2194159-2194188 30 NZ_CP022197 Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence 86101-86130 8 0.733
NZ_CP012517_1 1.6|2194159|30|NZ_CP012517|CRT 2194159-2194188 30 NZ_CP021117 Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence 6677-6706 8 0.733
NZ_CP012517_1 1.6|2194159|30|NZ_CP012517|CRT 2194159-2194188 30 NZ_CP004396 Celeribacter indicus strain P73 plasmid pP73C, complete sequence 64735-64764 8 0.733
NZ_CP012517_1 1.3|2194033|30|NZ_CP012517|CRT 2194033-2194062 30 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 227895-227924 9 0.7
NZ_CP012517_1 1.6|2194159|30|NZ_CP012517|CRT 2194159-2194188 30 NZ_CP040642 Agrobacterium sp. T29 plasmid unnamed2, complete sequence 53725-53754 9 0.7

1. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

2. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

3. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

4. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

5. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

6. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

7. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 1, identity: 0.958

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcgcccgacg	Protospacer
*************.**********

8. spacer 1.1|2193949|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 2, identity: 0.917

tcccgctcgccgtgctgttgttgc	CRISPR spacer
taccgctcgccgtgctgttgtcgc	Protospacer
* *******************.**

9. spacer 1.1|2193949|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 2, identity: 0.917

tcccgctcgccgtgctgttgttgc	CRISPR spacer
taccgctcgccgtgctgttgtcgc	Protospacer
* *******************.**

10. spacer 1.1|2193949|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 2, identity: 0.917

tcccgctcgccgtgctgttgttgc	CRISPR spacer
taccgctcgccgtgctgttgtcgc	Protospacer
* *******************.**

11. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcacccgacg	Protospacer
*************.**.*******

12. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcacccgacg	Protospacer
*************.**.*******

13. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttgtcacccgacg	Protospacer
*************.**.*******

14. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

15. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_019368 (Enterobacter cloacae plasmid pEl1573, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

16. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_KM877517 (Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

17. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_KP294351 (Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

18. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_KU315015 (Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

19. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP026156 (Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

20. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

21. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042501 (Enterobacter sp. E76 plasmid pE76_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

22. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP048339 (Escherichia coli strain 142 plasmid p142_B, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

23. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042509 (Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

24. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_LT994838 (Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

25. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042514 (Serratia marcescens strain E28 plasmid pE28_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

26. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

27. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP045511 (Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid p55k, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

28. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

29. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP017288 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3d, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

30. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

31. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to MG516907 (Klebsiella aerogenes plasmid pEa1631, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

32. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042532 (Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

33. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP017282 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1c, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

34. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_LT994833 (Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

35. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

36. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to KP294350 (Uncultured bacterium plasmid pARM26, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

37. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

38. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP048418 (Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

39. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP053283 (Escherichia coli strain SCU-308 plasmid pSCU-308-2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

40. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042574 (Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

41. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042542 (Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

42. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP014298 (Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

43. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042580 (Enterobacter kobei strain C16 plasmid pC16_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

44. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP026497 (Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

45. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

46. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP031216 (Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

47. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_011641 (Klebsiella pneumoniae plasmid pCTXM360, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

48. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_019344 (Serratia marcescens plasmid R830b, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

49. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042526 (Citrobacter freundii strain E11 plasmid pE11_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

50. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP031322 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

51. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_LT985264 (Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

52. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

53. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

54. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

55. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

56. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to MT193824 (Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

57. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_MF156266 (Escherichia coli strain 24-S11 plasmid pCESC2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

58. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042568 (Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

59. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_KM406490 (Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

60. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_KM406489 (Serratia marcescens strain R471 plasmid R471, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

61. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP035217 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

62. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556214 (Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

63. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556215 (Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

64. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556216 (Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

65. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556217 (Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

66. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556218 (Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

67. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556219 (Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

68. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556220 (Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

69. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556221 (Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

70. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to LC556222 (Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

71. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_024997 (Klebsiella oxytoca plasmid pACM1, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

72. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

73. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP017853 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2d, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

74. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to KU159086 (Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

75. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

76. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NZ_CP042490 (Enterobacter hormaechei strain C15 plasmid pC15_002) position: , mismatch: 2, identity: 0.917

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccttactgttatcgcccgacg	Protospacer
***** *.****************

77. spacer 1.1|2193949|24|NZ_CP012517|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 3, identity: 0.875

tcccgctcgccgtgctgttgttgc	CRISPR spacer
tgtcgatcgccgtgctgttgttgc	Protospacer
* .** ******************

78. spacer 1.2|2193991|24|NZ_CP012517|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgttggccgtgctgttgctgc	CRISPR spacer
atccgtttgccgcgctgttgctgc	Protospacer
 ****** ****.***********

79. spacer 1.5|2194117|24|NZ_CP012517|CRT matches to NZ_CP030363 (Salinibacter ruber strain SP73 plasmid pSR118, complete sequence) position: , mismatch: 3, identity: 0.875

ccccgttggccgtgctgttgctgc	CRISPR spacer
gcccgtcagccgtgctgttgctgc	Protospacer
 *****..****************

80. spacer 1.7|2194207|24|NZ_CP012517|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 3, identity: 0.875

tcgccgtgctgttatcgcccgacg	CRISPR spacer
tcgccgtgctgttctcgctcgacc	Protospacer
************* ****.**** 

81. spacer 1.8|2194249|24|NZ_CP012517|CRT matches to MH651171 (Mycobacterium phage Collard, complete genome) position: , mismatch: 3, identity: 0.875

tggctgtgctgttgctgcccgatg	CRISPR spacer
cgactgttctgttgctgcccgatg	Protospacer
.*.**** ****************

82. spacer 1.8|2194249|24|NZ_CP012517|CRT matches to NC_028947 (Mycobacterium phage Kratio, complete genome) position: , mismatch: 3, identity: 0.875

tggctgtgctgttgctgcccgatg	CRISPR spacer
cgactgttctgttgctgcccgatg	Protospacer
.*.**** ****************

83. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 5, identity: 0.833

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
taccgctcgccgtgctgttgtcgcccgacg	Protospacer
*.**  ************* ******* **

84. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 5, identity: 0.833

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
taccgctcgccgtgctgttgtcgcccgacg	Protospacer
*.**  ************* ******* **

85. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 5, identity: 0.833

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
taccgctcgccgtgctgttgtcgcccgacg	Protospacer
*.**  ************* ******* **

86. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.833

tgcctg-tcgccgtgctgttctcgcccgtcg	CRISPR spacer
-gctggctcgccgtgctgctgtcgcccgtcg	Protospacer
 **. * ***********.* **********

87. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

88. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

89. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

90. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

91. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

92. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

93. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

94. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

95. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

96. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

97. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

98. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

99. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

100. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

101. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

102. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

103. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

104. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

105. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

106. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

107. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

108. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

109. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

110. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

111. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

112. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

113. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

114. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

115. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

116. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

117. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

118. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

119. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

120. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

121. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

122. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

123. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

124. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

125. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

126. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

127. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

128. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

129. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

130. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

131. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

132. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

133. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

134. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

135. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

136. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

137. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

138. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

139. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

140. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

141. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

142. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

143. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

144. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

145. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

146. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

147. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

148. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

149. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

150. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

151. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

152. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

153. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

154. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

155. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

156. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

157. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

158. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

159. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

160. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

161. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

162. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

163. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
aaatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

164. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH371125 (Mycobacterium phage Morty, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

165. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

166. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

167. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccacgccgtggctggcca	Protospacer
*  .********.*******.******

168. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

169. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

170. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

171. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

172. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

173. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

174. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

175. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

176. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

177. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

178. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

179. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

180. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

181. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

182. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

183. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

184. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

185. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

186. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

187. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

188. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

189. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

190. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

191. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

192. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

193. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

194. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

195. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

196. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

197. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG925348 (Mycobacterium phage Megatron, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

198. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

199. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

200. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

201. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

202. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

203. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

204. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

205. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

206. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

207. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

208. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

209. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

210. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

211. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

212. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

213. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

214. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

215. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

216. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

217. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

218. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

219. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

220. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

221. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

222. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

223. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

224. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

225. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

226. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

227. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

228. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

229. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

230. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

231. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

232. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccacgccgtggctggcca	Protospacer
*  .********.*******.******

233. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

234. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

235. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

236. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

237. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

238. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

239. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

240. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

241. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

242. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

243. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

244. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

245. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

246. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

247. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

248. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

249. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

250. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

251. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

252. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

253. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF704091 (Mycobacterium phage ABU, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

254. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

255. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

256. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

257. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

258. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

259. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

260. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

261. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

262. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

263. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

264. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

265. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

266. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

267. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

268. spacer 2.2|3998475|27|NZ_CP012517|CRT matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
gcgccgctcccatgccgtggatggccg	Protospacer
.* *** ************* *****.

269. spacer 2.3|3998522|26|NZ_CP012517|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

270. spacer 2.3|3998522|26|NZ_CP012517|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

271. spacer 2.3|3998522|26|NZ_CP012517|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

272. spacer 2.3|3998522|26|NZ_CP012517|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

273. spacer 2.4|3998568|27|NZ_CP012517|CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggtcggcca	CRISPR spacer
aacccgatcccaggccgcggtcggccg	Protospacer
* .********* ****.********.

274. spacer 2.5|3998615|26|NZ_CP012517|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

275. spacer 2.5|3998615|26|NZ_CP012517|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

276. spacer 2.5|3998615|26|NZ_CP012517|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

277. spacer 2.5|3998615|26|NZ_CP012517|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

278. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

279. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

280. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

281. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

282. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

283. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

284. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

285. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

286. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

287. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

288. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

289. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

290. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

291. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

292. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

293. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

294. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

295. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

296. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

297. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

298. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

299. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

300. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

301. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

302. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

303. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

304. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

305. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

306. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

307. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

308. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

309. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

310. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

311. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

312. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

313. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

314. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

315. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

316. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

317. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

318. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

319. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

320. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

321. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

322. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

323. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

324. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

325. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

326. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

327. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

328. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

329. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

330. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

331. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

332. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

333. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

334. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

335. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

336. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

337. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

338. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

339. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

340. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

341. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

342. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

343. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

344. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

345. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

346. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

347. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

348. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

349. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

350. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

351. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

352. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

353. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

354. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
aaatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

355. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH371125 (Mycobacterium phage Morty, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

356. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

357. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

358. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccacgccgtggctggcca	Protospacer
*  .********.*******.******

359. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

360. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

361. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

362. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

363. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

364. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

365. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

366. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

367. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

368. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

369. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

370. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

371. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

372. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

373. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

374. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

375. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

376. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

377. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

378. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

379. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

380. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

381. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

382. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

383. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

384. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

385. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

386. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

387. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

388. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG925348 (Mycobacterium phage Megatron, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

389. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

390. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

391. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

392. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

393. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

394. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

395. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

396. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

397. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

398. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

399. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

400. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

401. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

402. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

403. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

404. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

405. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

406. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

407. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

408. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

409. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

410. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

411. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

412. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

413. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

414. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

415. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

416. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

417. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

418. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

419. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

420. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

421. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

422. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

423. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccacgccgtggctggcca	Protospacer
*  .********.*******.******

424. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

425. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

426. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

427. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

428. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

429. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

430. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

431. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

432. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

433. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

434. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

435. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

436. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

437. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

438. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

439. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

440. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

441. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

442. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

443. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

444. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF704091 (Mycobacterium phage ABU, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

445. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

446. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

447. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

448. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

449. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

450. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

451. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

452. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

453. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

454. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

455. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

456. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

457. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

458. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
agatcgatcccaagccgtggctggcca	Protospacer
*  .******** *******.******

459. spacer 2.6|3998661|27|NZ_CP012517|CRT matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtggttggcca	CRISPR spacer
gcgccgctcccatgccgtggatggccg	Protospacer
.* *** ************* *****.

460. spacer 2.7|3998708|26|NZ_CP012517|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

461. spacer 2.7|3998708|26|NZ_CP012517|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

462. spacer 2.7|3998708|26|NZ_CP012517|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

463. spacer 2.7|3998708|26|NZ_CP012517|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808

tactctggccccgcggcggtcgatcg	CRISPR spacer
ccctctggccccgcggcgggcgaaag	Protospacer
. ***************** ***  *

464. spacer 2.8|3998754|27|NZ_CP012517|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.815

actccgatcccatgccgtgatcggccg	CRISPR spacer
tcaccgattccatgccgtaatcggcct	Protospacer
 * *****.*********.******* 

465. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.8

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
tcaccgccgccgtgctgttcgcgctcgtcg	Protospacer
*  *.*.************* ***.*****

466. spacer 2.3|3998522|26|NZ_CP012517|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.769

tactctggccccgcggcggtcgatcg	CRISPR spacer
cggactggccccgctgcggtcgatca	Protospacer
..  ********** **********.

467. spacer 2.5|3998615|26|NZ_CP012517|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.769

tactctggccccgcggcggtcgatcg	CRISPR spacer
cggactggccccgctgcggtcgatca	Protospacer
..  ********** **********.

468. spacer 2.7|3998708|26|NZ_CP012517|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.769

tactctggccccgcggcggtcgatcg	CRISPR spacer
cggactggccccgctgcggtcgatca	Protospacer
..  ********** **********.

469. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 7, identity: 0.767

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
tcttcttccccgtgctgctctcgcccgtcg	Protospacer
* ... ** ********.************

470. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
ggtccgtcgccgtggtgctctcgcccgtgc	Protospacer
 *.*.********* **.**********  

471. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.767

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
ggcctatcggcgtgctgttctcgcagggct	Protospacer
 ****.*** **************  * * 

472. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.733

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
ggggcatcgccgtgctgttctcgctcgacc	Protospacer
 *  ..******************.** * 

473. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.733

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
aggccatcgccgtcctgttctcgcccgagt	Protospacer
 * *..******* *************   

474. spacer 1.6|2194159|30|NZ_CP012517|CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

tacccgtcgccgtgctgttctcaccggtcg	CRISPR spacer
cgagtttcgccgtgctgctgtcaccggtcg	Protospacer
..  . ***********.* **********

475. spacer 1.6|2194159|30|NZ_CP012517|CRT matches to NZ_CP021117 (Rhodobacteraceae bacterium strain G7 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

tacccgtcgccgtgctgttctcaccggtcg	CRISPR spacer
cgagtttcgccgtgctgctgtcaccggtcg	Protospacer
..  . ***********.* **********

476. spacer 1.6|2194159|30|NZ_CP012517|CRT matches to NZ_CP004396 (Celeribacter indicus strain P73 plasmid pP73C, complete sequence) position: , mismatch: 8, identity: 0.733

tacccgtcgccgtgctgttctcaccggtcg	CRISPR spacer
cgagtttcgccgtgctgctgtcaccggtcg	Protospacer
..  . ***********.* **********

477. spacer 1.3|2194033|30|NZ_CP012517|CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 9, identity: 0.7

tgcctgtcgccgtgctgttctcgcccgtcg	CRISPR spacer
acgacgtcgccgtgctgttctcggccgagc	Protospacer
    .****************** ***   

478. spacer 1.6|2194159|30|NZ_CP012517|CRT matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

tacccgtcgccgtgctgttctcaccggtcg	CRISPR spacer
ggattgtcgccgtcctgttctcaccgctgc	Protospacer
 . ..******** ************ *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 116560 : 207407 100 Burkholderia_phage(80.0%) tail,terminase,capsid,tRNA,head,portal,holin,plate,protease NA
DBSCAN-SWA_2 982329 : 993284 10 Streptococcus_phage(16.67%) protease NA
DBSCAN-SWA_3 1165311 : 1223107 62 uncultured_Caudovirales_phage(30.3%) tail,terminase,capsid,head,portal,plate,integrase,protease attL 1182705:1182740|attR 1228223:1228258
DBSCAN-SWA_4 1630532 : 1691566 56 Burkholderia_phage(20.0%) plate,transposase,coat NA
DBSCAN-SWA_5 2463622 : 2471819 14 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_6 2976361 : 2985237 9 Tanapox_virus(16.67%) NA NA
DBSCAN-SWA_7 3330623 : 3339868 7 unidentified_phage(16.67%) NA NA
DBSCAN-SWA_8 3622101 : 3680400 53 Burkholderia_phage(27.27%) tail,tRNA,transposase,plate,integrase attL 3626322:3626339|attR 3683594:3683611
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP012518
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012518_1 1445246-1445410 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012518_2 2678286-2678378 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012518_3 3118822-3118967 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 76038 : 142363 50 Ralstonia_phage(28.57%) plate,transposase,holin NA
DBSCAN-SWA_2 516260 : 527392 12 Burkholderia_virus(55.56%) transposase,integrase attL 511191:511207|attR 539256:539272
DBSCAN-SWA_3 680202 : 751695 55 Vibrio_phage(25.0%) plate,holin NA
DBSCAN-SWA_4 2307530 : 2325446 27 Burkholderia_phage(42.86%) integrase attL 2315091:2315106|attR 2326748:2326763
DBSCAN-SWA_5 2811627 : 2887443 48 Streptococcus_phage(14.29%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage