Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012647 Cutibacterium acnes strain KCOM 1861 (= ChDC B594) chromosome, complete genome 2 crisprs DEDDh,DinG,csa3,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 1 0 0

Results visualization

1. NZ_CP012647
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012647_1 1267254-1267338 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012647_2 2402231-2402320 TypeI-E NA
1 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012647_2 2.1|2402260|32|NZ_CP012647|CRISPRCasFinder 2402260-2402291 32 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 56038-56069 2 0.938
NZ_CP012647_2 2.1|2402260|32|NZ_CP012647|CRISPRCasFinder 2402260-2402291 32 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 129398-129429 9 0.719

1. spacer 2.1|2402260|32|NZ_CP012647|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

gagggctaccacgtggtcgatttggactgtcg	CRISPR spacer
gagggctacgacgtggtcgatttggactgttg	Protospacer
********* ********************.*

2. spacer 2.1|2402260|32|NZ_CP012647|CRISPRCasFinder matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gagggctaccacgtggtcgatttggactgtcg	CRISPR spacer
cagggctacgacgtggtcgatctggggctact	Protospacer
 ******** ***********.***. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage