Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP005971 Pseudomonas syringae UMAF0158 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP005970 Pseudomonas syringae UMAF0158 chromosome, complete genome 1 crisprs cas3,csa3,DinG,DEDDh,PD-DExK 0 1 6 0

Results visualization

1. NZ_CP005970
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP005970_1 1803158-1803249 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP005970_1 1.1|1803189|30|NZ_CP005970|CRISPRCasFinder 1803189-1803218 30 NZ_CP030100 Roseovarius sp. AK1035 plasmid unnamed, complete sequence 48454-48483 7 0.767

1. spacer 1.1|1803189|30|NZ_CP005970|CRISPRCasFinder matches to NZ_CP030100 (Roseovarius sp. AK1035 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tcgtgtcgcggctgccacgactatcgtcct	CRISPR spacer
cggtgtcgcggctgccccgacgatcgttgc	Protospacer
. ************** **** *****. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 233140 : 284810 72 Pseudomonas_phage(59.18%) tRNA,protease,tail,integrase,portal,capsid,head,terminase attL 240543:240593|attR 285834:285884
DBSCAN-SWA_2 1484925 : 1495381 12 uncultured_Caudovirales_phage(75.0%) tRNA NA
DBSCAN-SWA_3 2100402 : 2109998 7 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_4 3097001 : 3165691 72 Pseudomonas_phage(50.0%) lysis,bacteriocin,tRNA,tail,plate NA
DBSCAN-SWA_5 3233664 : 3294766 53 Bacillus_virus(14.29%) tRNA,holin,protease NA
DBSCAN-SWA_6 3450461 : 3512902 55 Pseudomonas_phage(16.67%) plate,integrase,protease attL 3440372:3440388|attR 3504120:3504136
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage