1. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
2. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
3. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
4. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
5. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
6. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
7. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
8. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
9. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
10. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
11. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
12. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
13. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
14. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
15. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
16. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
17. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
18. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
19. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
20. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
21. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
22. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
23. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
24. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
25. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
26. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
27. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
28. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
29. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
30. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
31. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
32. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
33. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
34. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
35. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
36. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
37. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
38. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
39. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
40. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
41. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
42. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
43. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
44. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
45. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
46. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
47. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
48. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
49. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
50. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
51. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
52. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
53. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
54. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
55. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
56. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
57. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
58. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
59. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
60. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
61. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
62. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
63. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
64. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
65. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
66. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
67. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
68. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
69. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
70. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
71. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
72. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
73. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
74. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
75. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
76. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.867
ttcggtgcgctggtcgatgcgctg--gtcgat CRISPR spacer
ttcggggcgctgttcgatgcgctgcagtcg-- Protospacer
***** ****** *********** ****
77. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_024957 (Methylibium sp. T29 plasmid pT29A, complete sequence) position: , mismatch: 5, identity: 0.833
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cccgatgcgctggtcgatgcgctgctcgac Protospacer
..**.******************* ****.
78. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_024958 (Methylibium sp. T29-B plasmid pT29B, complete sequence) position: , mismatch: 5, identity: 0.833
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cccgatgcgctggtcgatgcgctgctcgac Protospacer
..**.******************* ****.
79. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 5, identity: 0.833
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ttcaccgcgctggtcgaggcgctggacgat Protospacer
***. .*********** ******* ****
80. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
aacgatgcgcgggtcgatgcgctggtggct Protospacer
**.***** *************** * *
81. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.8
--ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gattc--cgcgcaggtcgatgcgctggtcgcc Protospacer
*** .**** ***************** .
82. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039643 (Azospirillum sp. TSA2s plasmid p3) position: , mismatch: 6, identity: 0.8
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgcgccgctggtcgatgcgccggccgat Protospacer
*** ***************.**.****
83. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaatggc Protospacer
********************** **..
84. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaatggc Protospacer
********************** **..
85. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_028969 (Brevibacillus phage Osiris, complete genome) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct Protospacer
*********** ******** **** *
86. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to KT151958 (Brevibacillus phage Powder, complete genome) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct Protospacer
*********** ******** **** *
87. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_029029 (Brevibacillus phage Abouo, complete genome) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct Protospacer
*********** ******** **** *
88. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_022980 (Brevibacillus phage Davies, complete genome) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ttcggtgcgctgttcggtgcgttgttacct Protospacer
*********** ******** **** *
89. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to MN317029 (Aeromonas phage vB_AhyS-A18P4, complete genome) position: , mismatch: 6, identity: 0.8
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
gtcggtgcgcgggtcggtgccgtcgatgtt Protospacer
********** ********* ** ** *
90. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
91. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
92. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
93. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
94. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
95. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
96. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
97. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
98. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
99. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
100. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
101. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
102. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
103. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
104. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
105. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
106. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
107. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacctgctggtcgatgcgctggccgag Protospacer
***.. .*****************.***
108. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
109. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
110. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
111. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_KX839207 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
112. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039920 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac Protospacer
.* *** *******************.
113. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ccccgcgcgcaggtcgatgcgctggtcgcc Protospacer
..* *.**** ***************** .
114. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
115. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
116. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac Protospacer
.* *** *******************.
117. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ccccgcgcgcaggtcgatgcgctggtcgcc Protospacer
..* *.**** ***************** .
118. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
119. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
120. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
121. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gctggtgcgctggacgatgcgctggcggac Protospacer
..********** ***********. **.
122. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gctggtgcgctggacgatgcgctggcggac Protospacer
..********** ***********. **.
123. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
accccggccctggtcgatgcgctggtcaat Protospacer
.* ** ******************.**
124. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
125. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
126. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gctggtgcgctggacgatgcgctggcggac Protospacer
..********** ***********. **.
127. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac Protospacer
.* *** *******************.
128. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026369 (Klebsiella quasipneumoniae strain A708 plasmid pA708-1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
129. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
130. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
131. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
132. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
133. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
134. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
acctctgccgtggtcgatgcgctggtcgac Protospacer
.* *** *******************.
135. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
136. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
137. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
138. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
139. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
140. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
141. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
142. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
143. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
144. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
145. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
146. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
147. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
148. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
149. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
150. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
151. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
152. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
153. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
154. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
155. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
156. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
157. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
158. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
159. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
160. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
161. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
162. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
163. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
164. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
165. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
166. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
167. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
168. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
169. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
170. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
171. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
172. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
173. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
174. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
175. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
176. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
177. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
178. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
179. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
180. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
181. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
182. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
183. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
184. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
185. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
186. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
187. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
188. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
189. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
190. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
191. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
192. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
193. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MF344567 (Klebsiella pneumoniae strain A708 plasmid pA708-IMP, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
194. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
195. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgtcccgcgctggttgatgcgctggtcgct Protospacer
* . .********.************* *
196. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
197. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
198. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
199. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgc----gctggtcgatgcgctggtcgat CRISPR spacer
----gagccggggctgatcgatgcgctggtcgag Protospacer
* ** ****.****************
200. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP021184 (Sphingomonas wittichii DC-6 plasmid pDC03, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgcatgacgctggccgatgcgctggtctat Protospacer
* *. .******.************* **
201. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
202. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_000958 (Deinococcus radiodurans R1 plasmid MP1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gccgacgcgctggtggatgcgctggccgac Protospacer
.**..******** **********.***.
203. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gtgcgagcggtggtcgatgcgcaggtcgag Protospacer
* * *** ************ ******
204. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgcatgacgctggccgatgcgctggtctat Protospacer
* *. .******.************* **
205. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
206. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
207. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
208. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
209. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
210. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
211. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gacgcgccgctggtcgatgcgcgggccgat Protospacer
** *************** **.****
212. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
213. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ttcggtgcgctggtcgatccggctctggaa Protospacer
****************** ** . * **
214. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gtgcgagcggtggtcgatgcgcaggtcgag Protospacer
* * *** ************ ******
215. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
216. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgatgcgccggtcgatgcgctgcgtgtt Protospacer
***.*****.************* .* *
217. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
218. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tgcatgacgctggccgatgcgctggtctat Protospacer
* *. .******.************* **
219. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctg------gtcgatgcgctggtcgat CRISPR spacer
------gtgctgccgcgcgtcgatgcgctggtcgat Protospacer
*.**** ******************
220. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP050118 (Deinococcus radiodurans strain BNK-50 plasmid pMP1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gccgacgcgctggtggatgcgctggccgac Protospacer
.**..******** **********.***.
221. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP050122 (Deinococcus radiodurans strain BND-54 plasmid pMP1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gccgacgcgctggtggatgcgctggccgac Protospacer
.**..******** **********.***.
222. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcgaggggctggtcgacgcgctggtcgac Protospacer
**. * *********.***********.
223. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcaacgcgctggtcgatgcgctgtccgac Protospacer
**...****************** .***.
224. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP031502 (Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence) position: , mismatch: 7, identity: 0.767
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gccgacgcgctggtggatgcgctggccgac Protospacer
.**..******** **********.***.
225. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
226. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
227. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
228. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
229. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
230. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
231. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
232. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
233. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
234. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
235. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
236. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcggtcaacggc Protospacer
********************** .*..
237. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
gtcggtgcgctgatcggtgcggtttgctcc Protospacer
************.********** * . .
238. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggcccgctggtcggtgcggtgcgcgag Protospacer
****. *****************. .**
239. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat--- CRISPR spacer
gtcagcgcgctggtcggtgcgg---tcgagacg Protospacer
***.*.**************** *.**
240. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
atcggcgcgctggtcggtgccgtgatgggg Protospacer
.****.************** *** * *.
241. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 7, identity: 0.767
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgcttgccggtgcggtggtcgta Protospacer
********** *.********** *.*
242. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcggtgcggtggtcgatgcgctgtgcttc Protospacer
******* ************** * .
243. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcaagcggctggtcgacgcgctggtcgat Protospacer
*.. *********.************
244. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cgacgtgcgcaggttgatgcgctggtcggc Protospacer
. ****** ***.*************..
245. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcaagcggctggtcgacgcgctggtcgat Protospacer
*.. *********.************
246. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcaagcggctggtggatgcgctggtcgat Protospacer
*.. ****** ***************
247. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gcgtttgcgctgatcgacgcgctggtcgaa Protospacer
. *******.****.***********
248. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gatgtcccgctggttgatgcgctggtcgct Protospacer
.* . *******.************* *
249. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcaagcggctggtcgacgcgctggtcgat Protospacer
*.. *********.************
250. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ctaagtgcgctggttgatgcgctggcttct Protospacer
.* .**********.**********.. *
251. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gacgatgcgctggtcgattcgctggcgcag Protospacer
**.************* ******. *
252. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP019227 (Xanthomonas oryzae pv. oryzae strain IX-280 plasmid pXOO43, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ctcggtgcgctgctcgatgcgcctggtttt Protospacer
.*********** *********. * . *
253. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gagagggtcctggtcgatgcgctggccgat Protospacer
.* *. ****************.****
254. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
tccggtgcgctgatcgaagcgctggagacc Protospacer
*.**********.**** ******* . .
255. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP013632 (Rhizobium sp. N324 plasmid pRspN324b, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgatgcgccggtcgatgcgctgcatatt Protospacer
***.*****.************* .. *
256. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgatgcgccggtcgatgcgctgcatatt Protospacer
***.*****.************* .. *
257. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ttcggggcgctggtcgatgcggcccgcaag Protospacer
***** *************** . *.*
258. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gagtgcgcgctgggcgatgcgctcgtcgac Protospacer
*.******* ********* *****.
259. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ctaagtgcgctggttgatgcgctggcttct Protospacer
.* .**********.**********.. *
260. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gccctgccgccggtcgatgcgctggtccat Protospacer
.* ***.**************** **
261. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gtctatgcgctggccgatgcgctggtgcgg Protospacer
** .********.************ .
262. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cccaccccgcaggtcgaggcgctggtcgat Protospacer
..*. . *** ****** ************
263. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
---ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
aaatcc---acgctggtcaatgcgctggtcggg Protospacer
*.* .********.************.
264. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcagtgcgccggtcgatgggctggtctgg Protospacer
*.******.******** ******* .
265. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgatgcgccggtcgatgcgctgcgtatt Protospacer
***.*****.************* .. *
266. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgacgcgctggtcgatgcgctgaatgcc Protospacer
***..******************. .* .
267. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
atcgatgcgccggtcgatgcgctgcatatt Protospacer
***.*****.************* .. *
268. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ctaagtgcgctggttgatgcgctggcttct Protospacer
.* .**********.**********.. *
269. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ctttcggcgctcgtcgaggcgctggtcgac Protospacer
.*. ***** ***** ***********.
270. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggctttgcgctggtcggtgcggtggtcggc Protospacer
* ***********.**** ******..
271. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 8, identity: 0.733
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gtctatgcgctggccgatgcgctggtgcgg Protospacer
** .********.************ .
272. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP029051 (Miniimonas sp. S16 plasmid pS16-2, complete sequence) position: , mismatch: 8, identity: 0.733
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
cgcggtgcggtggtcggtgcggtgtcgacg Protospacer
******* ***************. .
273. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.733
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggcgcgctggtcggtgcggtcaacggc Protospacer
****.***************** .*..
274. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.733
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggtgcgctggtcggtgcagtcaacggc Protospacer
*******************.** .*..
275. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.733
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ctcggcgcgctggtcggtgcggtcaacggc Protospacer
****.***************** .*..
276. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP027794 (Rhodococcus hoagii strain DSSKP-R-001 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ttcggtgcgctggacggtgcggccgtggcg Protospacer
************ ********. * *
277. spacer 1.3|2698192|30|NZ_CP012192|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
gtcggtgcgctggtcggtgcggtgtttgat CRISPR spacer
ttcggtgcgctggtcgttgcggcggtgttg Protospacer
*************** *****.* *
278. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
ggcaagcggctggtggatgcgctggtcgac Protospacer
*.. ****** **************.
279. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gcgattgcgctggtcggtgcgctgctcgtc Protospacer
. . ***********.******* *** .
280. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cttacccggctggtcgaagcgctggtcgaa Protospacer
.*.. . ********* ***********
281. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cgtgatgcgctgctcgatgcgctggtgccg Protospacer
. .*.******* *************
282. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gctttcgcgctgctcgatgcgctggacgag Protospacer
.. .****** ************ ***
283. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gcaggtgcgctggacgatccgctggtgctg Protospacer
. ********** **** *******
284. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gacggggcgctggtcgaggcgctggcgcgc Protospacer
*** *********** *******. ..
285. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gccaaccaactggtcaatgcgctggtcgat Protospacer
.*... .******.**************
286. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 10, identity: 0.667
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
cagcagaagctggtcgatgcgctcgtcgag Protospacer
. . . *************** *****
287. spacer 1.1|2698108|30|NZ_CP012192|CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 10, identity: 0.667
ttcggtgcgctggtcgatgcgctggtcgat CRISPR spacer
gagcgtgcgctggccgatgcgctggcgacc Protospacer
*********.***********. . .