Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012679 Pseudomonas aeruginosa strain PA1RG chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,DinG,WYL 1 0 7 0

Results visualization

1. NZ_CP012679
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012679_1 339823-339936 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012679_2 3542657-3542770 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012679_2 2.1|3542685|58|NZ_CP012679|CRISPRCasFinder 3542685-3542742 58 NZ_CP012679.1 792454-792511 0 1.0

1. spacer 2.1|3542685|58|NZ_CP012679|CRISPRCasFinder matches to position: 792454-792511, mismatch: 0, identity: 1.0

cggataacgccggtggcgttattcgccctacggcccgactccggggccgcgggacgca	CRISPR spacer
cggataacgccggtggcgttattcgccctacggcccgactccggggccgcgggacgca	Protospacer
**********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 60524 : 117686 53 Shigella_phage(20.0%) plate,transposase NA
DBSCAN-SWA_2 637841 : 718393 86 Pseudomonas_phage(35.9%) plate,tail,tRNA NA
DBSCAN-SWA_3 1187237 : 1281609 104 Pseudomonas_phage(57.14%) protease,tail,capsid,tRNA,head,holin,integrase,portal,terminase attL 1203680:1203700|attR 1286976:1286996
DBSCAN-SWA_4 1422633 : 1486012 84 Pseudomonas_phage(85.0%) protease,tail,capsid,tRNA,integrase,holin,head,portal,terminase attL 1443196:1443214|attR 1493339:1493357
DBSCAN-SWA_5 1530727 : 1539756 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_6 2630529 : 2637423 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_7 3464484 : 3502925 50 Pseudomonas_phage(35.0%) plate,tail,capsid,integrase,lysis,transposase attL 3452464:3452480|attR 3482831:3482847
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage