Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010552 Candidatus Thioglobus autotrophicus strain EF1 chromosome, complete genome 2 crisprs DEDDh,DinG,cas3,csa3,cas6 0 1 7 0

Results visualization

1. NZ_CP010552
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010552_1 106882-106986 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010552_2 1427447-1427609 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010552_1 1.1|106921|27|NZ_CP010552|CRISPRCasFinder 106921-106947 27 NZ_CP039728 Bacillus sp. S3 plasmid unnamed, complete sequence 127891-127917 5 0.815

1. spacer 1.1|106921|27|NZ_CP010552|CRISPRCasFinder matches to NZ_CP039728 (Bacillus sp. S3 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

caacaaggtcaggcaaaaaagcaagga	CRISPR spacer
gctgaaggtcaggcaaaaaaacaagga	Protospacer
    ****************.******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 223948 : 233317 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_2 282335 : 292034 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_3 363303 : 424101 59 Shigella_phage(17.65%) tRNA,holin,transposase NA
DBSCAN-SWA_4 481540 : 489493 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_5 1121044 : 1134126 9 Bacillus_phage(28.57%) tRNA NA
DBSCAN-SWA_6 1410933 : 1418169 9 Escherichia_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1440978 : 1451023 10 Klosneuvirus(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage