Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012909 Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP012910 Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP012908 Ketogulonicigenium vulgare strain Hbe602 chromosome, complete genome 2 crisprs csa3,WYL,DEDDh,cas3,cas5,cas8c,cas7,cas4,cas1,cas2 0 5 5 0

Results visualization

1. NZ_CP012908
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012908_1 1852360-1853053 TypeI I-C
10 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012908_2 2139791-2139890 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NC_017903 Escherichia coli Xuzhou21 plasmid pO157_Sal, complete sequence 24723-24756 6 0.824
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NC_011148 Salmonella enterica subsp. enterica serovar Agona str. SL483 plasmid, complete sequence 37052-37085 7 0.794
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_KU963390 Escherichia coli strain ECO37 plasmid ECO37P2, complete sequence 30385-30418 7 0.794
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_CP010193 Escherichia coli strain M8 plasmid B, complete genome 33332-33365 7 0.794
NZ_CP012908_1 1.6|1852722|33|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852722-1852754 33 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 45464-45496 7 0.788
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_CP049247 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence 18758-18791 8 0.765
NZ_CP012908_1 1.10|1852995|34|NZ_CP012908|PILER-CR 1852995-1853028 34 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 539756-539789 8 0.765
NZ_CP012908_1 1.14|1852988|34|NZ_CP012908|CRISPRCasFinder,CRT 1852988-1853021 34 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 539756-539789 8 0.765
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_CP019707 Pantoea alhagi strain LTYR-11Z plasmid pPALTYR11Z, complete sequence 62089-62122 9 0.735
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_CP007740 Bacillus methanolicus MGA3 plasmid pBM69, complete sequence 16414-16447 9 0.735
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_LT222315 Pseudomonas cerasi isolate Sour cherry (Prunus cerasus) symptomatic leaf plasmid p58T3 108477-108510 10 0.706
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_LT963398 Pseudomonas cerasi isolate PL963 plasmid PP3, complete sequence 75521-75554 10 0.706
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 CP034538 Pseudomonas poae strain CAP-2018 plasmid unnamed 107853-107886 10 0.706
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NC_008738 Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU01, complete sequence 62733-62766 10 0.706
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NC_007678 Salinibacter ruber DSM 13855 plasmid pSR35, complete sequence 14814-14847 10 0.706
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_AP022559 Geobacillus subterraneus strain E55-1 plasmid pGspE55-2, complete sequence 821-854 10 0.706
NZ_CP012908_1 1.16|1852854|35|NZ_CP012908|CRT 1852854-1852888 35 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 984065-984099 10 0.714
NZ_CP012908_1 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT 1852656-1852689 34 NZ_CP029542 Streptomyces sp. NEAU-S7GS2 plasmid unnamed1, complete sequence 9497-9530 11 0.676

1. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NC_017903 (Escherichia coli Xuzhou21 plasmid pO157_Sal, complete sequence) position: , mismatch: 6, identity: 0.824

tcccata-aaaaaacccgcctctaagggcgggctg	CRISPR spacer
-gcgacacaaaaaacccgcctctaagggcgggtta	Protospacer
  * *.* ************************.*.

2. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NC_011148 (Salmonella enterica subsp. enterica serovar Agona str. SL483 plasmid, complete sequence) position: , mismatch: 7, identity: 0.794

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
cgacacaaaaaaacccgcctctaaggacgggtta	Protospacer
.  **.********************.****.*.

3. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU963390 (Escherichia coli strain ECO37 plasmid ECO37P2, complete sequence) position: , mismatch: 7, identity: 0.794

-tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
gcttcat-aaaaaacccgcctctaaaggcgggtta	Protospacer
 ...*** *****************.******.*.

4. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010193 (Escherichia coli strain M8 plasmid B, complete genome) position: , mismatch: 7, identity: 0.794

-tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
gcttcat-aaaaaacccgcctctaaaggcgggtta	Protospacer
 ...*** *****************.******.*.

5. spacer 1.6|1852722|33|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 7, identity: 0.788

tgcttccg--gtaaaactccaccgcagcgtggaac	CRISPR spacer
--ccgccgacgtgaaacaccaccgcagcgtggaag	Protospacer
  *. ***  **.**** **************** 

6. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049247 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
gggcaacaaaaaacccgcctcgaggggcgggctt	Protospacer
   **  ************** *.********* 

7. spacer 1.10|1852995|34|NZ_CP012908|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.765

cccagcaggcgcggcgcagacgacaggcgggacg	CRISPR spacer
atcgacgggcgcggcgcagacgacaggcaagacc	Protospacer
 .*..*.*********************..*** 

8. spacer 1.14|1852988|34|NZ_CP012908|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.765

cccagcaggcgcggcgcagacgacaggcgggacg	CRISPR spacer
atcgacgggcgcggcgcagacgacaggcaagacc	Protospacer
 .*..*.*********************..*** 

9. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019707 (Pantoea alhagi strain LTYR-11Z plasmid pPALTYR11Z, complete sequence) position: , mismatch: 9, identity: 0.735

tcccataa------aaaaacccgcctctaagggcgggctg	CRISPR spacer
------aaaggcttaaaaaaccgcctctaagggcggtctt	Protospacer
      **      ***** **************** ** 

10. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007740 (Bacillus methanolicus MGA3 plasmid pBM69, complete sequence) position: , mismatch: 9, identity: 0.735

tcccataaaaaaacccgcctctaagg-gcgggctg	CRISPR spacer
aaccataaaaatacccccctctaaggtgtttgtt-	Protospacer
  ********* **** ********* *.  *.* 

11. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT222315 (Pseudomonas cerasi isolate Sour cherry (Prunus cerasus) symptomatic leaf plasmid p58T3) position: , mismatch: 10, identity: 0.706

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
caaaacgaaaaaacccgcctattagggcgggttt	Protospacer
.   *..************* * ********.* 

12. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963398 (Pseudomonas cerasi isolate PL963 plasmid PP3, complete sequence) position: , mismatch: 10, identity: 0.706

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
caaaacgaaaaaacccgcctattagggcgggttt	Protospacer
.   *..************* * ********.* 

13. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to CP034538 (Pseudomonas poae strain CAP-2018 plasmid unnamed) position: , mismatch: 10, identity: 0.706

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
acttcacaaaaaacccgcctttaatggcgggttt	Protospacer
 *..   *************.*** ******.* 

14. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NC_008738 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU01, complete sequence) position: , mismatch: 10, identity: 0.706

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
agaaaacaaaaaacccgcctcaatgggcgggttt	Protospacer
    *  ************** * *******.* 

15. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NC_007678 (Salinibacter ruber DSM 13855 plasmid pSR35, complete sequence) position: , mismatch: 10, identity: 0.706

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
agtcagtaaaaaacccgcctttacgggcggggca	Protospacer
  .**  *************.** ******* ..

16. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022559 (Geobacillus subterraneus strain E55-1 plasmid pGspE55-2, complete sequence) position: , mismatch: 10, identity: 0.706

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
gaaaaataaaaaacccgcctcaaaaggcggggtc	Protospacer
    *  ************** **.****** * 

17. spacer 1.16|1852854|35|NZ_CP012908|CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.714

gcgaccaatggcgcgtagcgacaccctatcaggac	CRISPR spacer
acgacgaatggcgcgtcgcgacacccatctgcaac	Protospacer
.**** ********** *********  ... .**

18. spacer 1.5|1852656|34|NZ_CP012908|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029542 (Streptomyces sp. NEAU-S7GS2 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcccataaaaaaacccgcctctaagggcgggctg	CRISPR spacer
cgtaacgaaaaaacccgcctcggagggcgggact	Protospacer
. . *..************** .******** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 566387 : 574781 10 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_2 1085790 : 1098821 16 Paracoccus_phage(33.33%) protease,capsid,tail,head,portal NA
DBSCAN-SWA_3 1143883 : 1165933 30 Rhodobacter_phage(22.22%) protease,capsid,tail,integrase,portal,terminase attL 1137700:1137716|attR 1166124:1166140
DBSCAN-SWA_4 1288690 : 1295903 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 2031741 : 2085950 63 Paracoccus_phage(13.04%) protease,capsid,tail,head,portal,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage