Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012996 Pedobacter sp. PACM 27299, complete genome 5 crisprs DEDDh,csa3,WYL,c2c10_CAS-V-U3 1 0 4 0

Results visualization

1. NZ_CP012996
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012996_1 725893-725988 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012996_2 2529551-2529949 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012996_3 4656511-4656668 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012996_4 4952922-4953029 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012996_5 5567712-5567904 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012996_1 1.1|725919|44|NZ_CP012996|CRISPRCasFinder 725919-725962 44 NZ_CP012996.1 2031229-2031272 0 1.0
NZ_CP012996_1 1.1|725919|44|NZ_CP012996|CRISPRCasFinder 725919-725962 44 NZ_CP012996.1 2102176-2102219 0 1.0
NZ_CP012996_1 1.1|725919|44|NZ_CP012996|CRISPRCasFinder 725919-725962 44 NZ_CP012996.1 5740710-5740753 0 1.0
NZ_CP012996_1 1.1|725919|44|NZ_CP012996|CRISPRCasFinder 725919-725962 44 NZ_CP012996.1 852961-853004 0 1.0

1. spacer 1.1|725919|44|NZ_CP012996|CRISPRCasFinder matches to position: 2031229-2031272, mismatch: 0, identity: 1.0

agagataaaattatagctttgtctatctatatcccattttattt	CRISPR spacer
agagataaaattatagctttgtctatctatatcccattttattt	Protospacer
********************************************

2. spacer 1.1|725919|44|NZ_CP012996|CRISPRCasFinder matches to position: 2102176-2102219, mismatch: 0, identity: 1.0

agagataaaattatagctttgtctatctatatcccattttattt	CRISPR spacer
agagataaaattatagctttgtctatctatatcccattttattt	Protospacer
********************************************

3. spacer 1.1|725919|44|NZ_CP012996|CRISPRCasFinder matches to position: 5740710-5740753, mismatch: 0, identity: 1.0

agagataaaattatagctttgtctatctatatcccattttattt	CRISPR spacer
agagataaaattatagctttgtctatctatatcccattttattt	Protospacer
********************************************

4. spacer 1.1|725919|44|NZ_CP012996|CRISPRCasFinder matches to position: 852961-853004, mismatch: 0, identity: 1.0

agagataaaattatagctttgtctatctatatcccattttattt	CRISPR spacer
agagataaaattatagctttgtctatctatatcccattttattt	Protospacer
********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1919318 : 1945995 21 Escherichia_phage(57.14%) transposase,protease NA
DBSCAN-SWA_2 2401850 : 2410279 9 Salmonella_phage(16.67%) NA NA
DBSCAN-SWA_3 2493492 : 2502662 7 Hokovirus(33.33%) NA NA
DBSCAN-SWA_4 5552755 : 5560425 7 Trichoplusia_ni_ascovirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage