Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013021 Agarivorans gilvus strain WH0801, complete genome 2 crisprs DEDDh,DinG,cas6f,cas7f,cas5f,csa3,cas3,WYL,RT 0 2 4 0

Results visualization

1. NZ_CP013021
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013021_1 815655-815803 Unclear NA
2 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013021_2 3633651-3633740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 178615-178645 6 0.806
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 484809-484839 6 0.806
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 62076-62106 6 0.806
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 NZ_CP045607 Bacillus cereus strain SB1 plasmid p1, complete sequence 381843-381873 6 0.806
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 570093-570123 6 0.806
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 NC_020385 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence 237758-237788 6 0.806
NZ_CP013021_1 1.2|815744|31|NZ_CP013021|CRISPRCasFinder 815744-815774 31 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 201191-201221 6 0.806
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_LT838202 Escherichia coli isolate WI2 isolate plasmid pWI2-OXA48, complete sequence 45747-45777 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_KX009507 Escherichia coli strain 06K2206 plasmid LM6771, complete sequence 87403-87433 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_019368 Enterobacter cloacae plasmid pEl1573, complete sequence 42676-42706 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_KM877517 Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence 124565-124595 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_KP294351 Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence 65948-65978 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_KU315015 Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence 87195-87225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026156 Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence 49608-49638 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_004464 Citrobacter freundii plasmid pCTX-M3, complete sequence 45689-45719 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042501 Enterobacter sp. E76 plasmid pE76_002, complete sequence 87352-87382 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP048339 Escherichia coli strain 142 plasmid p142_B, complete sequence 50084-50114 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042509 Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence 72821-72851 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026194 Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence 73473-73503 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_LT994838 Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence 33067-33097 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042514 Serratia marcescens strain E28 plasmid pE28_002, complete sequence 78542-78572 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_LT985387 Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI 49735-49765 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP045511 Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid p55k, complete sequence 45718-45748 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC508263 Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence 42418-42448 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP007733 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-068, complete sequence 5246-5276 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_019063 Escherichia coli plasmid pNDM-HK, complete sequence 80152-80182 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 MG516907 Klebsiella aerogenes plasmid pEa1631, complete sequence 42676-42706 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP009857 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-d0d, complete sequence 65387-65417 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042532 Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence 78542-78572 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026385 Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence 38574-38604 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_LT994833 Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence 32005-32035 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP031235 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence 22260-22290 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 KP294350 Uncultured bacterium plasmid pARM26, complete sequence 78057-78087 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC536683 Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence 71606-71636 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP048418 Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence 47279-47309 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042574 Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence 77215-77245 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042542 Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence 78542-78572 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP014298 Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence 45585-45615 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042580 Enterobacter kobei strain C16 plasmid pC16_002, complete sequence 72821-72851 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026497 Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence 45954-45984 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026188 Enterobacteriaceae bacterium ENNIH2 plasmid pKPC-ddab, complete sequence 75140-75170 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 15162-15192 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP031216 Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence 29253-29283 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_011641 Klebsiella pneumoniae plasmid pCTXM360, complete sequence 15969-15999 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_019344 Serratia marcescens plasmid R830b, complete sequence 58617-58647 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042526 Citrobacter freundii strain E11 plasmid pE11_002, complete sequence 78542-78572 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP031322 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence 6963-6993 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_LT985264 Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence 70280-70310 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_LT985241 Escherichia coli strain 721 plasmid RCS40_p, complete sequence 72181-72211 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC505604 Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence 42418-42448 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC508722 Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence 42418-42448 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_019889 Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence 28806-28836 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 MT193824 Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence 23164-23194 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042568 Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence 78542-78572 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_KM406490 Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence 14642-14672 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_KM406489 Serratia marcescens strain R471 plasmid R471, complete sequence 71400-71430 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP035217 Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence 64227-64257 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556214 Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556215 Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556216 Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556217 Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556218 Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556219 Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556220 Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556221 Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 LC556222 Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence 14195-14225 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NC_024997 Klebsiella oxytoca plasmid pACM1, complete sequence 50793-50823 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 47901-47931 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP009852 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-e56, complete sequence 52839-52869 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026395 Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence 43952-43982 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP026210 Citrobacter sp. CFNIH10 plasmid pKPC-2fe2, complete sequence 64299-64329 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 KU159086 Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence 11071-11101 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP032193 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence 52432-52462 8 0.742
NZ_CP013021_1 1.1|815684|31|NZ_CP013021|CRISPRCasFinder 815684-815714 31 NZ_CP042490 Enterobacter hormaechei strain C15 plasmid pC15_002 11070-11100 8 0.742

1. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

2. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

3. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

4. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP045607 (Bacillus cereus strain SB1 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

5. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

6. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to NC_020385 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

7. spacer 1.2|815744|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 6, identity: 0.806

aggtatttcaaacaatacttaatggcgtgac-	CRISPR spacer
aggtatttcaaacaaatcttaat-gcttatcg	Protospacer
***************  ****** ** *. * 

8. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_LT838202 (Escherichia coli isolate WI2 isolate plasmid pWI2-OXA48, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

9. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

10. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_019368 (Enterobacter cloacae plasmid pEl1573, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

11. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_KM877517 (Enterobacter cloacae strain CRE623 plasmid pIMP-HB623, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

12. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_KP294351 (Escherichia coli strain CZD1527 plasmid pIGT15, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

13. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_KU315015 (Serratia marcescens strain NCTC 50331 plasmid R1215, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

14. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026156 (Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

15. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

16. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042501 (Enterobacter sp. E76 plasmid pE76_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

17. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP048339 (Escherichia coli strain 142 plasmid p142_B, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

18. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042509 (Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

19. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026194 (Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

20. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_LT994838 (Klebsiella variicola isolate CNR130 plasmid CNR130, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

21. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042514 (Serratia marcescens strain E28 plasmid pE28_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

22. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

23. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP045511 (Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid p55k, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

24. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

25. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP007733 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-068, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

26. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

27. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to MG516907 (Klebsiella aerogenes plasmid pEa1631, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

28. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP009857 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-d0d, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

29. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042532 (Klebsiella aerogenes strain C9 plasmid pC9_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

30. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026385 (Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

31. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_LT994833 (Klebsiella pneumoniae isolate CNR341 plasmid CNR341, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

32. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

33. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to KP294350 (Uncultured bacterium plasmid pARM26, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

34. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

35. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP048418 (Citrobacter freundii strain CitB plasmid pB_CitB, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

36. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042574 (Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

37. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042542 (Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

38. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP014298 (Klebsiella pneumoniae strain KP38731 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

39. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042580 (Enterobacter kobei strain C16 plasmid pC16_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

40. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026497 (Klebsiella pneumoniae strain 616 plasmid pKp616_2, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

41. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026188 (Enterobacteriaceae bacterium ENNIH2 plasmid pKPC-ddab, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

42. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

43. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP031216 (Escherichia coli strain Es_ST80_L1_NDM_10_2017 plasmid pEsST80_L1_NDM, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

44. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_011641 (Klebsiella pneumoniae plasmid pCTXM360, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

45. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_019344 (Serratia marcescens plasmid R830b, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

46. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042526 (Citrobacter freundii strain E11 plasmid pE11_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

47. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP031322 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_NDM, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

48. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_LT985264 (Escherichia coli strain 717 plasmid RCS51TR717_p, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

49. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

50. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

51. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

52. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

53. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to MT193824 (Escherichia coli strain 19-AB01443 plasmid pOX-48-EC1443, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

54. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042568 (Enterobacter hormaechei strain C44 plasmid pC44_002, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

55. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_KM406490 (Salmonella enterica subsp. enterica serovar Typhimurium strain 202 plasmid pSEM, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

56. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_KM406489 (Serratia marcescens strain R471 plasmid R471, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

57. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP035217 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-C, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

58. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556214 (Escherichia coli CEX24 plasmid pCEX24 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

59. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556215 (Escherichia coli CEX25 plasmid pCEX25 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

60. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556216 (Escherichia coli CEX14 plasmid pCEX14 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

61. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556217 (Escherichia coli CEX3 plasmid pCEX3 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

62. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556218 (Enterobacter cloacae CEX5 plasmid pCEX5 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

63. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556219 (Enterobacter cloacae CEX6 plasmid pCEX6 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

64. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556220 (Enterobacter cloacae CEX4 plasmid pCEX4 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

65. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556221 (Klebsiella pneumoniae CEX18 plasmid pCEX18 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

66. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to LC556222 (Klebsiella pneumoniae CEX23 plasmid pCEX23 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

67. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NC_024997 (Klebsiella oxytoca plasmid pACM1, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

68. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

69. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP009852 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-e56, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

70. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026395 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPC-edb7, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

71. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP026210 (Citrobacter sp. CFNIH10 plasmid pKPC-2fe2, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

72. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to KU159086 (Klebsiella pneumoniae plasmid pOXAAPSS2, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

73. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

74. spacer 1.1|815684|31|NZ_CP013021|CRISPRCasFinder matches to NZ_CP042490 (Enterobacter hormaechei strain C15 plasmid pC15_002) position: , mismatch: 8, identity: 0.742

tggtggcacaatcgttactggtatatccctg	CRISPR spacer
cggtggcaaaatcgttagtggtattgccgct	Protospacer
.******* ******** ******  ** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1972673 : 1982829 15 Vibrio_phage(37.5%) NA NA
DBSCAN-SWA_2 1986498 : 1994234 12 Vibrio_phage(37.5%) NA NA
DBSCAN-SWA_3 2488320 : 2532709 40 uncultured_Caudovirales_phage(42.86%) transposase,plate NA
DBSCAN-SWA_4 3349801 : 3425018 59 Vibrio_phage(40.0%) protease,transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage