Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008751 Brucella melitensis strain 20236 isolate Bme20236 chromosome 2, complete sequence 0 crisprs csa3,cas3,DEDDh 0 0 99 0
NZ_CP008750 Brucella melitensis strain 20236 isolate Bme20236 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 3 0

Results visualization

1. NZ_CP008751
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13522 11 Staphylococcus_phage(33.33%) protease NA
DBSCAN-SWA_2 24181 : 27695 5 Pithovirus(25.0%) NA NA
DBSCAN-SWA_3 33088 : 37293 4 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_4 44325 : 44796 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 69195 : 74411 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_6 79611 : 81474 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 86428 : 90897 5 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_8 97315 : 98449 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_9 108115 : 110682 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_10 129775 : 130756 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_11 136434 : 141809 6 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_12 167345 : 173573 6 Tupanvirus(66.67%) tRNA NA
DBSCAN-SWA_13 178838 : 194254 13 uncultured_virus(28.57%) tRNA NA
DBSCAN-SWA_14 199382 : 199634 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_15 203153 : 205025 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_16 221860 : 223036 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_17 232526 : 233339 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_18 242129 : 243050 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_19 246780 : 247608 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_20 252899 : 254750 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_21 260996 : 261992 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 265308 : 265749 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 271176 : 272154 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_24 279168 : 282933 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_25 291214 : 292216 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_26 295319 : 301277 5 Erysipelothrix_phage(20.0%) NA NA
DBSCAN-SWA_27 306441 : 307509 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_28 326041 : 337149 8 Hokovirus(25.0%) NA NA
DBSCAN-SWA_29 341054 : 342617 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_30 355025 : 369821 12 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_31 384752 : 385823 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_32 389856 : 390579 1 Bartonella_henselae_phage(100.0%) NA NA
DBSCAN-SWA_33 403813 : 411276 6 Stenotrophomonas_phage(33.33%) NA NA
DBSCAN-SWA_34 414420 : 415308 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 418998 : 423943 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_36 431212 : 435290 5 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_37 441381 : 442098 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_38 453906 : 455043 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_39 467236 : 470640 2 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_40 480273 : 481275 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_41 485538 : 490833 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_42 494585 : 496196 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_43 502742 : 507597 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_44 511805 : 512565 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_45 515741 : 518180 3 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_46 527855 : 529418 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_47 543965 : 547257 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_48 557172 : 559272 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_49 564713 : 568823 4 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_50 571891 : 588568 16 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_51 603877 : 604681 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_52 610852 : 612315 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_53 618698 : 623818 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_54 633628 : 636292 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_55 642608 : 649117 5 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_56 658643 : 665954 5 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_57 673454 : 678911 5 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_58 687892 : 690691 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 702826 : 703993 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_60 707001 : 708832 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_61 712025 : 715146 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_62 723977 : 725513 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_63 736781 : 743913 6 Cyanophage(25.0%) NA NA
DBSCAN-SWA_64 752989 : 753646 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_65 762417 : 764003 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_66 771441 : 775413 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_67 779369 : 782450 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_68 797476 : 798034 1 Geobacillus_phage(100.0%) NA NA
DBSCAN-SWA_69 801947 : 807653 3 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_70 815295 : 817771 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_71 824873 : 826418 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_72 836070 : 844106 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_73 849880 : 860814 12 Klosneuvirus(40.0%) tRNA NA
DBSCAN-SWA_74 866885 : 874456 7 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_75 895984 : 896482 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_76 901907 : 903497 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_77 915276 : 919473 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_78 922776 : 936110 15 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_79 943976 : 947389 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_80 961077 : 961899 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_81 971042 : 977998 6 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_82 981403 : 982162 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_83 993446 : 996046 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_84 1000037 : 1004870 5 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_85 1012814 : 1014644 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_86 1025785 : 1030194 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_87 1033991 : 1038584 5 Shigella_phage(33.33%) transposase NA
DBSCAN-SWA_88 1042896 : 1043973 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_89 1049068 : 1051035 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_90 1055237 : 1057237 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_91 1074976 : 1077011 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_92 1080934 : 1082111 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_93 1092841 : 1093738 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_94 1129025 : 1130561 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_95 1142485 : 1145129 2 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_96 1156840 : 1157545 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_97 1162788 : 1163961 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_98 1167681 : 1168395 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_99 1177127 : 1184281 8 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP008750
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008750_1 658884-658966 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008750_1 1.1|658912|27|NZ_CP008750|CRISPRCasFinder 658912-658938 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|658912|27|NZ_CP008750|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ataagatgcgcgcaaggaaagatctgt	CRISPR spacer
aacagatgctctcaaggaaagatctga	Protospacer
*  ****** * ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 546683 : 649763 96 Paracoccus_phage(15.0%) capsid,integrase,head,tail,protease,portal,transposase attL 642338:642352|attR 652373:652387
DBSCAN-SWA_2 874936 : 886848 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 957556 : 965895 10 Brucella_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage