Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011964 Bifidobacterium longum subsp. longum strain NCIMB8809 chromosome, complete genome 5 crisprs WYL,DEDDh,casR 0 1 4 0

Results visualization

1. NZ_CP011964
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011964_1 156629-156997 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011964_2 394168-394292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011964_3 1378065-1378145 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011964_4 1594367-1594498 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011964_5 2083529-2083602 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011964_1 1.5|156890|24|NZ_CP011964|CRISPRCasFinder 156890-156913 24 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 98015-98038 3 0.875
NZ_CP011964_1 1.5|156890|24|NZ_CP011964|CRISPRCasFinder 156890-156913 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1789555-1789578 4 0.833

1. spacer 1.5|156890|24|NZ_CP011964|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atcggttccgcagccggctgccgg	CRISPR spacer
atcggttccgcagcgggcagccgt	Protospacer
************** *** **** 

2. spacer 1.5|156890|24|NZ_CP011964|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

atcggttccgcagccggctgccgg	CRISPR spacer
gtcggttccgccgccggctgcctc	Protospacer
.********** **********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 785743 : 848724 46 Tupanvirus(12.5%) protease,transposase NA
DBSCAN-SWA_2 1241251 : 1296409 43 Gordonia_phage(16.67%) integrase,tRNA,transposase attL 1260782:1260797|attR 1299887:1299902
DBSCAN-SWA_3 1990882 : 2023057 34 Propionibacterium_phage(27.78%) portal,capsid,transposase,integrase,protease,tail,head attL 2002372:2002390|attR 2028047:2028065
DBSCAN-SWA_4 2304176 : 2314116 9 Mycobacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage