Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012680 Pseudomonas brassicacearum strain LBUM300 chromosome, complete genome 4 crisprs DEDDh,RT,DinG,csa3,cas3,WYL 1 0 6 0

Results visualization

1. NZ_CP012680
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012680_1 1517032-1517164 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012680_2 1628738-1628832 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012680_3 2297110-2297208 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012680_4 3889026-3889121 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012680_1 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder 1517077-1517119 43 NZ_CP012680.1 366652-366694 1 0.977
NZ_CP012680_1 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder 1517077-1517119 43 NZ_CP012680.1 1298973-1299015 1 0.977
NZ_CP012680_1 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder 1517077-1517119 43 NZ_CP012680.1 1301109-1301151 1 0.977
NZ_CP012680_1 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder 1517077-1517119 43 NZ_CP012680.1 6627895-6627937 1 0.977

1. spacer 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder matches to position: 366652-366694, mismatch: 1, identity: 0.977

gttctcccggtcgtacacccatcagatctgtttgagcaggacc	CRISPR spacer
gttctcccggtcgtacacccctcagatctgtttgagcaggacc	Protospacer
******************** **********************

2. spacer 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder matches to position: 1298973-1299015, mismatch: 1, identity: 0.977

gttctcccggtcgtacacccatcagatctgtttgagcaggacc	CRISPR spacer
gttctcctggtcgtacacccatcagatctgtttgagcaggacc	Protospacer
*******.***********************************

3. spacer 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder matches to position: 1301109-1301151, mismatch: 1, identity: 0.977

gttctcccggtcgtacacccatcagatctgtttgagcaggacc	CRISPR spacer
gttctcctggtcgtacacccatcagatctgtttgagcaggacc	Protospacer
*******.***********************************

4. spacer 1.1|1517077|43|NZ_CP012680|CRISPRCasFinder matches to position: 6627895-6627937, mismatch: 1, identity: 0.977

gttctcccggtcgtacacccatcagatctgtttgagcaggacc	CRISPR spacer
gttctcccggtcgtacatccatcagatctgtttgagcaggacc	Protospacer
*****************.*************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15461 : 101141 59 uncultured_Caudovirales_phage(22.22%) protease,plate NA
DBSCAN-SWA_2 1208930 : 1234543 39 Pseudomonas_phage(45.16%) terminase,holin,lysis NA
DBSCAN-SWA_3 1574368 : 1647268 70 Pseudomonas_phage(25.0%) tRNA,tail,holin,plate,protease NA
DBSCAN-SWA_4 3695359 : 3738046 40 Yersinia_phage(25.0%) protease,transposase NA
DBSCAN-SWA_5 4625270 : 4631536 8 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_6 6551559 : 6603110 44 Burkholderia_phage(33.33%) protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage