Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013351 Pseudoalteromonas issachenkonii strain KCTC 12958 chromosome II, complete sequence 0 crisprs csa3,cas3,DinG 0 0 0 0
NZ_CP013350 Pseudoalteromonas issachenkonii strain KCTC 12958 chromosome I, complete sequence 2 crisprs DinG,DEDDh,cas3,cas6f,cas7f,cas5f,csa3 0 1 0 0

Results visualization

1. NZ_CP013350
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013350_1 447276-447398 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013350_2 2350467-2350703 Orphan NA
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013350_1 1.1|447322|31|NZ_CP013350|CRISPRCasFinder 447322-447352 31 NC_010802 Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence 43453-43483 9 0.71
NZ_CP013350_1 1.1|447322|31|NZ_CP013350|CRISPRCasFinder 447322-447352 31 NC_010070 Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence 70003-70033 9 0.71

1. spacer 1.1|447322|31|NZ_CP013350|CRISPRCasFinder matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 9, identity: 0.71

ccagaatgtaggacgcgacccgtcgcgcact	CRISPR spacer
ggaagttgcaggacgcgacacgtcgcgcaga	Protospacer
  *.. **.********** *********  

2. spacer 1.1|447322|31|NZ_CP013350|CRISPRCasFinder matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 9, identity: 0.71

ccagaatgtaggacgcgacccgtcgcgcact	CRISPR spacer
ggaagttgcaggacgcgacacgtcgcgcaga	Protospacer
  *.. **.********** *********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage