1. spacer 2.13|1027044|39|NZ_LN831027|PILER-CR matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 2, identity: 0.949
tacaattaaaaaaatgtttagactactgcaaagagaaag CRISPR spacer
ttcaattaaaaaaatgtttagactactgcaaagaaaaag Protospacer
* ********************************.****
2. spacer 2.26|1027899|38|NZ_LN831027|PILER-CR matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 2, identity: 0.947
tagttctgttgcagcttttatctttgcataatcactta CRISPR spacer
tagttctattgcagcttttacctttgcataatcactta Protospacer
*******.************.*****************
3. spacer 2.31|1026379|37|NZ_LN831027|CRISPRCasFinder,CRT matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 2, identity: 0.946
aaatggtatttgtaaagttgatttctttatactctta CRISPR spacer
aaatggaatttgcaaagttgatttctttatactctta Protospacer
****** *****.************************
4. spacer 2.41|1027045|38|NZ_LN831027|CRISPRCasFinder,CRT matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 2, identity: 0.947
acaattaaaaaaatgtttagactactgcaaagagaaag CRISPR spacer
tcaattaaaaaaatgtttagactactgcaaagaaaaag Protospacer
********************************.****
5. spacer 2.54|1027900|37|NZ_LN831027|CRISPRCasFinder,CRT matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 2, identity: 0.946
agttctgttgcagcttttatctttgcataatcactta CRISPR spacer
agttctattgcagcttttacctttgcataatcactta Protospacer
******.************.*****************
6. spacer 2.3|1026378|38|NZ_LN831027|PILER-CR matches to KR131710 (Fusobacterium phage Funu1, complete genome) position: , mismatch: 3, identity: 0.921
taaatggtatttgtaaagttgatttctttatactctta CRISPR spacer
aaaatggaatttgcaaagttgatttctttatactctta Protospacer
****** *****.************************
7. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
8. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
9. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
10. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
11. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
12. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP023854 (Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
13. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KX458222 (Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
14. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP048377 (Escherichia coli strain 38 plasmid p38_A-OXA140, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
15. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
16. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
17. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
18. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
19. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP034956 (Escherichia coli strain SCEC020026 plasmid pCTXM15_020026, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
20. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KT754160 (Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
21. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
22. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP048338 (Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
23. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
24. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
25. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
26. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MT077881 (Escherichia coli plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
27. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP010372 (Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
28. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP020519 (Escherichia coli strain 222 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
29. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MN158990 (Escherichia coli strain TREC4 plasmid pTREC4, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
30. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP051693 (Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
31. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_024986 (Vibrio parahaemolyticus strain 13511/A1 plasmid pTetB-VA1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
32. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP019268 (Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
33. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP020496 (Escherichia coli strain 103 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
34. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_018998 (Escherichia coli F18+ plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
35. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP023351 (Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
36. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MG516912 (Proteus penneri plasmid pPp47, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
37. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP040922 (Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
38. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024652 (Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
39. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_011409 (Haemophilus influenzae plasmid ICEhin1056, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
40. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to LC081338 (Vibrio sp. 04Ya108 plasmid pSEA1 DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
41. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024831 (Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
42. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP008715 (Escherichia coli strain ST648 plasmid pEC648_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
43. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024863 (Escherichia coli strain AR_0015 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
44. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP009232 (Escherichia coli strain CA28 plasmid pCA28, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
45. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
46. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
47. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
48. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MG516911 (Proteus mirabilis plasmid pPm60, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
49. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP048345 (Escherichia coli strain 124 plasmid p124_A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
50. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP030921 (Escherichia coli strain KL53 plasmid pKL53-M, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
51. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_019122 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
52. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_032099 (Shigella dysenteriae 1 strain 92-9000 plasmid p92-9000, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
53. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025751 (Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
54. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP048311 (Escherichia coli strain 32-4 plasmid p32-4_A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
55. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
56. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
57. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
58. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
59. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
60. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
61. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
62. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP018947 (Escherichia coli strain Ecol_224 plasmid pEC224_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
63. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP018960 (Escherichia coli strain Ecol_422 plasmid pEC422_2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
64. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024805 (Escherichia coli strain AMA1167 plasmid pAMA1167-NDM-5, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
65. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP023959 (Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
66. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP019001 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
67. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_002134 (Shigella flexneri 2b plasmid R100 DNA, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
68. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
69. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
70. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP021880 (Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
71. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_009133 (Escherichia coli plasmid NR1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
72. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029979 (Escherichia coli strain 99-3165 plasmid unnamed1) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
73. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
74. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
75. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
76. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
77. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025139 (Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
78. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to AP023221 (Escherichia coli M505 plasmid pM505-a DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
79. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to AP023225 (Escherichia coli YJ1 plasmid pYJ1-NDM5 DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
80. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to AP023238 (Escherichia coli F070 plasmid pF070-NDM5 DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
81. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
82. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
83. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
84. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_019117 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
85. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP023145 (Escherichia coli strain CFSAN061770 plasmid pEGY3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
86. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029744 (Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
87. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP026778 (Shigella dysenteriae strain 69-3818 plasmid unnamed1) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
88. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP015836 (Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
89. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
90. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
91. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
92. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
93. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
94. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_AP018352 (Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
95. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_011812 (Escherichia coli plasmid pO26-L, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
96. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
97. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
98. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
99. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
100. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
101. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025253 (Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
102. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP033761 (Escherichia coli strain FDAARGOS_536 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
103. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
104. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
105. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
106. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to JX127248 (Uncultured bacterium plasmid pRSB225, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
107. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP044051 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
108. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025254 (Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
109. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP014320 (Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
110. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK291500 (Escherichia coli strain 15978 plasmid pHN15978-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
111. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK758104 (Escherichia coli strain 0126:B16 plasmid R16, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
112. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
113. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK797990 (Salmonella enterica subsp. enterica serovar Wien strain ZM3 plasmid pZM3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
114. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MN328348 (Salmonella enterica subsp. enterica serovar Enteritidis strain S14 plasmid pTS14, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
115. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP018299 (Photobacterium damselae strain Phdp Wu-1 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
116. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MH105051 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncHI2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
117. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MH760469 (Salmonella enterica strain 2016K-0796 plasmid p2016K-0796, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
118. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MH523448 (Klebsiella pneumoniae strain KL8 plasmid pKL8-NDM, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
119. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
120. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
121. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MF156697 (Escherichia coli strain BTR plasmid pBTR-CTXM, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
122. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MH202955 (Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
123. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP047640 (Proteus sp. ZN5 plasmid pZN5-103kb, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
124. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LC492469 (Escherichia coli strain M216 plasmid pM216_mF, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
125. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MF156715 (Citrobacter freundii strain P5571 plasmid pP5571-MDR, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
126. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
127. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP023816 (Escherichia coli strain IMT16316 plasmid pEcIMT16316, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
128. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP033514 (Vibrio cholerae strain E4 plasmid pVCR94, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
129. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
130. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_015965 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
131. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to KR827684 (Escherichia coli plasmid pCERC3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
132. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KM406488 (Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
133. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KP789020 (Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
134. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP042337 (Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
135. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP040398 (Escherichia coli strain BA22372 plasmid pCTX-M-15_22372, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
136. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025539 (Vibrio harveyi strain 345 plasmid p345-185, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
137. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP034401 (Escherichia coli strain CRE10 plasmid pCRE10.1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
138. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KT754167 (Shigella dysenteriae 1 strain 69-3818 plasmid p69-3818, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
139. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
140. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KT754164 (Shigella dysenteriae 1 strain 3099-85 plasmid p3099-85, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
141. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
142. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to LN850163 (Escherichia coli plasmid pI1-34TF, strain I1-34) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
143. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
144. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
145. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024247 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
146. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
147. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP019251 (Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
148. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MT077880 (Escherichia coli plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
149. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_025127 (Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
150. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
151. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
152. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP027130 (Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
153. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP053576 (Salmonella enterica strain 2012K-0845 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
154. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP030329 (Escherichia coli strain AR_452 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
155. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP027119 (Escherichia coli strain 26561 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
156. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MK492260 (Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
157. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP034667 (Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
158. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP015131 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
159. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_005014 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
160. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP017221 (Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
161. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024816 (Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
162. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024039 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ndm, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
163. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_009139 (Yersinia ruckeri YR71 plasmid pYR1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
164. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
165. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
166. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025737 (Salmonella enterica strain FORC_079 plasmid pFORC79_2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
167. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
168. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP033400 (Escherichia coli strain WCHEC020031 plasmid pOXA1_020031, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
169. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP050997 (Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_1) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
170. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
171. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
172. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP037947 (Escherichia coli strain CFSAN027346 plasmid pCFSAN027346-2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
173. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
174. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
175. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP023369 (Escherichia coli strain 1428 plasmid p66, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
176. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP043407 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_01, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
177. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_016983 (Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
178. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
179. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
180. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP027554 (Escherichia coli strain 2013C-3513 plasmid unnamed1) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
181. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP048648 (Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
182. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP034396 (Escherichia coli strain CRE1 plasmid pCRE1.1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
183. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP045540 (Proteus mirabilis strain CRE14IB plasmid pIB_NDM_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
184. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
185. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP025708 (Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
186. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP034301 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
187. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to KX957971 (Vibrio parahaemolyticus plasmid pVPS62, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
188. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_011743 (Escherichia fergusonii ATCC 35469 plasmid pEFER, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
189. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
190. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
191. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to AP019705 (Escherichia coli O145:H28 10942 plasmid pO145_10942_2 DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
192. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
193. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to AP023228 (Escherichia coli YJ3 plasmid pYJ3-a DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
194. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to AP023232 (Escherichia coli YJ4 plasmid pYJ4-a DNA, complete genome) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
195. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
196. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP027703 (Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
197. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_018954 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
198. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_018966 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pSSAP03302A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
199. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_AP019191 (Escherichia coli strain M629-2 plasmid pM629-2-NDM5, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
200. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
201. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_AP014806 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-3, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
202. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
203. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP026474 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869A, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
204. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
205. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
206. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LT985304 (Escherichia coli strain ECOR 31 plasmid RCS89_p, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
207. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP026934 (Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
208. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to MN807689 (Escherichia coli strain A241 plasmid pA241-TEM, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
209. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LR595692 (Escherichia coli isolate EcMAD1 plasmid pEcMAD1) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
210. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK878891 (Escherichia coli strain J53 plasmid pMG336, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
211. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK878890 (Escherichia coli strain J53 plasmid pMG337, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
212. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_AP018939 (Escherichia coli strain JSWP006 plasmid pJSWP006_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
213. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MH422552 (Escherichia coli strain L-I1 plasmid pIncFIB, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
214. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP006635 (Escherichia coli PCN033 plasmid p3PCN033, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
215. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
216. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MF344581 (Enterobacter cloacae strain 13E573 plasmid p13E573-HI2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
217. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MG702490 (Escherichia coli strain CC1702-01 plasmid pD2-NDM_1_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
218. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MG702492 (Escherichia coli strain CC1706-01 plasmid pD6-NDM_1_1, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
219. spacer 2.40|1026980|35|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP044190 (Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence) position: , mismatch: 9, identity: 0.743
taaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
aaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
220. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP022484 (Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
221. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_007171 (Staphylococcus haemolyticus JCSC1435 plasmid pSHaeC, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagttctttttcttcttctgtcatttctctag Protospacer
. * * .***********.************ .
222. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
223. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP008815 (Enterococcus faecalis ATCC 29212 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
224. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
225. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP028721 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
226. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_013388 (Staphylococcus sp. CDC25 plasmid SAP018B, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttctgtcatttctctag Protospacer
. * *..***********.************ .
227. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
228. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
229. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
230. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatattattttttcttctttagtcattgctactc Protospacer
. * **************** ****** ** ..
231. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to MN693392 (Marine virus AFVG_25M95, complete genome) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
caacctatcatttcttcttttgtcatttctcgac Protospacer
*.***. *********************
232. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to MN693151 (Marine virus AFVG_25M560, complete genome) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attgatattttttcttctagtgtcatttcgttct Protospacer
..* ************* ********* .**
233. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aagttgagtttttcttcgtttgtaatttctctta Protospacer
. .* * ********* ***** ********.*
234. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to AP013554 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C28-MedDCM-OCT-S23-C36, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
ttttttatttcttcatcttttgtcattttttccc Protospacer
.*.******.*** *************.*..*
235. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to KR131711 (Fusobacterium phage Funu2 supercont1.1, partial genome) position: , mismatch: 9, identity: 0.735
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
tttgcaactttttcatctcttgtcatttctctaa Protospacer
.* . *.****** ***.************* *
236. spacer 2.51|1027703|36|NZ_LN831027|CRISPRCasFinder,CRT matches to DQ227763 (Lactococcus phage 712, complete genome) position: , mismatch: 9, identity: 0.75
cccttataagtagcaaattcttttgtaaaactttct CRISPR spacer
tcaaagtaagtagcaaattcttttgtcaaagtttta Protospacer
.* .******************** *** ***.
237. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
238. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
239. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
240. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
241. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
242. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP023854 (Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
243. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KX458222 (Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
244. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP048377 (Escherichia coli strain 38 plasmid p38_A-OXA140, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
245. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
246. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
247. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
248. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
249. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP034956 (Escherichia coli strain SCEC020026 plasmid pCTXM15_020026, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
250. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KT754160 (Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
251. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
252. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP048338 (Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
253. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
254. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
255. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
256. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MT077881 (Escherichia coli plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
257. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP010372 (Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
258. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP020519 (Escherichia coli strain 222 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
259. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MN158990 (Escherichia coli strain TREC4 plasmid pTREC4, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
260. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP051693 (Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
261. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_024986 (Vibrio parahaemolyticus strain 13511/A1 plasmid pTetB-VA1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
262. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP019268 (Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
263. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP020496 (Escherichia coli strain 103 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
264. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_018998 (Escherichia coli F18+ plasmid pTC1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
265. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP023351 (Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
266. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MG516912 (Proteus penneri plasmid pPp47, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
267. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP040922 (Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
268. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024652 (Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
269. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_011409 (Haemophilus influenzae plasmid ICEhin1056, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
270. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to LC081338 (Vibrio sp. 04Ya108 plasmid pSEA1 DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
271. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024831 (Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
272. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP008715 (Escherichia coli strain ST648 plasmid pEC648_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
273. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024863 (Escherichia coli strain AR_0015 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
274. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP009232 (Escherichia coli strain CA28 plasmid pCA28, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
275. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_024960 (Escherichia coli plasmid pIS04_68, strain ISO4, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
276. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
277. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
278. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MG516911 (Proteus mirabilis plasmid pPm60, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
279. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP048345 (Escherichia coli strain 124 plasmid p124_A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
280. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP030921 (Escherichia coli strain KL53 plasmid pKL53-M, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
281. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_019122 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
282. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_032099 (Shigella dysenteriae 1 strain 92-9000 plasmid p92-9000, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
283. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025751 (Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
284. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP048311 (Escherichia coli strain 32-4 plasmid p32-4_A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
285. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
286. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
287. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
288. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
289. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
290. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
291. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
292. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP018947 (Escherichia coli strain Ecol_224 plasmid pEC224_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
293. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP018960 (Escherichia coli strain Ecol_422 plasmid pEC422_2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
294. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024805 (Escherichia coli strain AMA1167 plasmid pAMA1167-NDM-5, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
295. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP023959 (Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
296. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP019001 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
297. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_002134 (Shigella flexneri 2b plasmid R100 DNA, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
298. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
299. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
300. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP021880 (Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
301. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_009133 (Escherichia coli plasmid NR1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
302. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029979 (Escherichia coli strain 99-3165 plasmid unnamed1) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
303. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
304. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
305. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
306. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
307. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025139 (Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
308. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to AP023221 (Escherichia coli M505 plasmid pM505-a DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
309. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to AP023225 (Escherichia coli YJ1 plasmid pYJ1-NDM5 DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
310. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to AP023238 (Escherichia coli F070 plasmid pF070-NDM5 DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
311. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
312. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
313. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
314. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_019117 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
315. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP023145 (Escherichia coli strain CFSAN061770 plasmid pEGY3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
316. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029744 (Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
317. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP026778 (Shigella dysenteriae strain 69-3818 plasmid unnamed1) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
318. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP015836 (Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
319. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
320. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
321. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
322. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
323. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
324. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_AP018352 (Enterobacter hormaechei strain TUM11043 plasmid pMTY11043_IncHI2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
325. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_011812 (Escherichia coli plasmid pO26-L, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
326. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
327. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
328. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
329. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
330. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
331. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025253 (Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
332. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP033761 (Escherichia coli strain FDAARGOS_536 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
333. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
334. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
335. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
336. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to JX127248 (Uncultured bacterium plasmid pRSB225, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
337. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP044051 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
338. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025254 (Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
339. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP014320 (Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
340. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK291500 (Escherichia coli strain 15978 plasmid pHN15978-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
341. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK758104 (Escherichia coli strain 0126:B16 plasmid R16, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
342. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
343. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK797990 (Salmonella enterica subsp. enterica serovar Wien strain ZM3 plasmid pZM3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
344. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MN328348 (Salmonella enterica subsp. enterica serovar Enteritidis strain S14 plasmid pTS14, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
345. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP018299 (Photobacterium damselae strain Phdp Wu-1 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
346. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MH105051 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncHI2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
347. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MH760469 (Salmonella enterica strain 2016K-0796 plasmid p2016K-0796, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
348. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MH523448 (Klebsiella pneumoniae strain KL8 plasmid pKL8-NDM, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
349. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
350. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
351. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MF156697 (Escherichia coli strain BTR plasmid pBTR-CTXM, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
352. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MH202955 (Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
353. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP047640 (Proteus sp. ZN5 plasmid pZN5-103kb, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
354. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LC492469 (Escherichia coli strain M216 plasmid pM216_mF, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
355. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MF156715 (Citrobacter freundii strain P5571 plasmid pP5571-MDR, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
356. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
357. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP023816 (Escherichia coli strain IMT16316 plasmid pEcIMT16316, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
358. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP033514 (Vibrio cholerae strain E4 plasmid pVCR94, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
359. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
360. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_015965 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
361. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to KR827684 (Escherichia coli plasmid pCERC3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
362. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KM406488 (Salmonella enterica subsp. enterica serovar Paratyphi B strain R69 plasmid R69, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
363. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KP789020 (Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
364. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP042337 (Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
365. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP040398 (Escherichia coli strain BA22372 plasmid pCTX-M-15_22372, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
366. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025539 (Vibrio harveyi strain 345 plasmid p345-185, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
367. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP034401 (Escherichia coli strain CRE10 plasmid pCRE10.1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
368. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KT754167 (Shigella dysenteriae 1 strain 69-3818 plasmid p69-3818, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
369. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
370. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_KT754164 (Shigella dysenteriae 1 strain 3099-85 plasmid p3099-85, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
371. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
372. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to LN850163 (Escherichia coli plasmid pI1-34TF, strain I1-34) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
373. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
374. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to JN102342 (Uncultured bacterium plasmid pRSB203, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
375. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024247 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
376. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
377. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP019251 (Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
378. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MT077880 (Escherichia coli plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
379. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_025127 (Vibrio sp. 04Ya090 plasmid pAQU2 DNA, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
380. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
381. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
382. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP027130 (Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
383. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP053576 (Salmonella enterica strain 2012K-0845 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
384. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP030329 (Escherichia coli strain AR_452 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
385. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP027119 (Escherichia coli strain 26561 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
386. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MK492260 (Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
387. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP034667 (Proteus vulgaris strain PvSC3 plasmid pPvSC3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
388. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP015131 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
389. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_005014 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R64, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
390. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP017221 (Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
391. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024816 (Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
392. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024039 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ndm, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
393. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_009139 (Yersinia ruckeri YR71 plasmid pYR1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
394. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_023911 (Raoultella planticola strain KpNDM1 plasmid pKpNDM1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
395. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
396. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025737 (Salmonella enterica strain FORC_079 plasmid pFORC79_2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
397. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
398. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP033400 (Escherichia coli strain WCHEC020031 plasmid pOXA1_020031, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
399. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP050997 (Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_1) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
400. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
401. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
402. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP037947 (Escherichia coli strain CFSAN027346 plasmid pCFSAN027346-2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
403. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
404. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
405. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP023369 (Escherichia coli strain 1428 plasmid p66, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
406. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP043407 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_01, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
407. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_016983 (Photobacterium damselae subsp. damselae plasmid pAQU1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
408. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
409. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP029248 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_D, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
410. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP027554 (Escherichia coli strain 2013C-3513 plasmid unnamed1) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
411. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP048648 (Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
412. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP034396 (Escherichia coli strain CRE1 plasmid pCRE1.1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
413. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP045540 (Proteus mirabilis strain CRE14IB plasmid pIB_NDM_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
414. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
415. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP025708 (Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
416. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP034301 (Vibrio parahaemolyticus strain 20160303005-1 plasmid pVPSD2016-2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
417. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to KX957971 (Vibrio parahaemolyticus plasmid pVPS62, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
418. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_011743 (Escherichia fergusonii ATCC 35469 plasmid pEFER, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
419. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
420. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
421. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to AP019705 (Escherichia coli O145:H28 10942 plasmid pO145_10942_2 DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
422. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
423. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to AP023228 (Escherichia coli YJ3 plasmid pYJ3-a DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
424. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to AP023232 (Escherichia coli YJ4 plasmid pYJ4-a DNA, complete genome) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
425. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
426. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP027703 (Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
427. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_018954 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
428. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_018966 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pSSAP03302A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
429. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_AP019191 (Escherichia coli strain M629-2 plasmid pM629-2-NDM5, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
430. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
431. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_AP014806 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-3, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
432. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
433. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP026474 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869A, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
434. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP024910 (Enterobacter hormaechei subsp. xiangfangensis strain OSUKPC4_L plasmid pOSUKPC4, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
435. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
436. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LT985304 (Escherichia coli strain ECOR 31 plasmid RCS89_p, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
437. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP026934 (Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
438. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to MN807689 (Escherichia coli strain A241 plasmid pA241-TEM, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
439. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_LR595692 (Escherichia coli isolate EcMAD1 plasmid pEcMAD1) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
440. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK878891 (Escherichia coli strain J53 plasmid pMG336, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
441. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MK878890 (Escherichia coli strain J53 plasmid pMG337, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
442. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_AP018939 (Escherichia coli strain JSWP006 plasmid pJSWP006_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
443. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MH422552 (Escherichia coli strain L-I1 plasmid pIncFIB, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
444. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP006635 (Escherichia coli PCN033 plasmid p3PCN033, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
445. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
446. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MF344581 (Enterobacter cloacae strain 13E573 plasmid p13E573-HI2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
447. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MG702490 (Escherichia coli strain CC1702-01 plasmid pD2-NDM_1_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
448. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_MG702492 (Escherichia coli strain CC1706-01 plasmid pD6-NDM_1_1, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
449. spacer 2.12|1026979|36|NZ_LN831027|PILER-CR matches to NZ_CP044190 (Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence) position: , mismatch: 10, identity: 0.722
ttaaataaaaataagcaacaagaaaattaaatcttt CRISPR spacer
gaaaataaaaatcatcaacaagaaaattttaagagt Protospacer
********** * ************* * *
450. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP022484 (Enterococcus faecalis ARO1/DG plasmid pARO1.1, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
451. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP008815 (Enterococcus faecalis ATCC 29212 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
452. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP030046 (Enterococcus faecalis strain C54 plasmid pC54, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
453. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to MN693392 (Marine virus AFVG_25M95, complete genome) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
ccaacctatcatttcttcttttgtcatttctcgac Protospacer
. *.***. *********************
454. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP036248 (Enterococcus faecalis R712 plasmid pR712_02, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
455. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP028721 (Enterococcus faecalis strain CVM N48037F plasmid pN48037F-1, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
456. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
457. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
458. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_CP042217 (Enterococcus faecalis strain L8 plasmid pL8, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
459. spacer 2.15|1027177|35|NZ_LN831027|PILER-CR matches to NZ_MK140641 (Enterococcus faecalis strain E035 plasmid pE035, complete sequence) position: , mismatch: 10, identity: 0.714
tgctcttattttttcttcttttgtcatttctctca CRISPR spacer
caatattattttttcttctttagtcattgctactc Protospacer
.. * **************** ****** ** ..
460. spacer 2.23|1027702|37|NZ_LN831027|PILER-CR matches to DQ227763 (Lactococcus phage 712, complete genome) position: , mismatch: 10, identity: 0.73
tcccttataagtagcaaattcttttgtaaaactttct CRISPR spacer
atcaaagtaagtagcaaattcttttgtcaaagtttta Protospacer
.* .******************** *** ***.
461. spacer 2.23|1027702|37|NZ_LN831027|PILER-CR matches to MT002873 (Tenacibaculum phage JQ, complete genome) position: , mismatch: 10, identity: 0.73
tcccttataagtagcaaattcttttgtaaaactttct CRISPR spacer
ttttttataagtagcaaagtcttttataaactctacc Protospacer
*...************** ******.**** ..* *.
462. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039210 (Piscirickettsia salmonis strain Psal-103 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
463. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP048067 (Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
464. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_KX712120 (Staphylococcus haemolyticus isolate 131A plasmid p131A, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
465. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039033 (Piscirickettsia salmonis strain Psal-070 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
466. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038894 (Piscirickettsia salmonis strain Psal-006a plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
467. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038924 (Piscirickettsia salmonis strain Psal-011 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
468. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038953 (Piscirickettsia salmonis strain Psal-040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
469. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038958 (Piscirickettsia salmonis strain Psal-041 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
470. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039196 (Piscirickettsia salmonis strain Psal-161 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
471. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038812 (Piscirickettsia salmonis strain Psal-001 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
472. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP013769 (Piscirickettsia salmonis strain PM23019A plasmid p1PS3, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
473. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LR735433 (Staphylococcus epidermidis strain none isolate Se_RP62a-WT plasmid 2) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcggtcatttctctag Protospacer
. * *..***********. *********** .
474. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_019145 (Staphylococcus aureus plasmid pUR2355, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
475. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_019147 (Staphylococcus aureus plasmid pUR4128, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
476. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP033942 (Piscirickettsia salmonis strain EM-90 plasmid pPSEM90-5, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
477. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP013763 (Piscirickettsia salmonis strain PM21567A plasmid p1PS2, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
478. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
479. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP013761 (Piscirickettsia salmonis strain AY6492A plasmid p4PS1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
480. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP013774 (Piscirickettsia salmonis strain PM37984A plasmid p1PS4, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
481. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP013779 (Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
482. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP050945 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
483. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038892 (Piscirickettsia salmonis strain Psal-005 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
484. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038914 (Piscirickettsia salmonis strain Psal-010a plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
485. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038968 (Piscirickettsia salmonis strain Psal-068 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
486. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP054009 (Staphylococcus hominis strain FDAARGOS_762 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
487. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP010403 (Staphylococcus aureus subsp. aureus strain GR2 plasmid pGR2A, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
488. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039202 (Piscirickettsia salmonis strain Psal-163 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
489. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039205 (Piscirickettsia salmonis strain Psal-182 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
490. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_022618 (Staphylococcus epidermidis plasmid pSWS47, isolate 47, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcggtcatttctctag Protospacer
. * *..***********. *********** .
491. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039042 (Piscirickettsia salmonis strain Psal-072 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
492. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039182 (Piscirickettsia salmonis strain Psal-158 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
493. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_LN831038 (Staphylococcus aureus strain NCTC13435 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
494. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_006663 (Staphylococcus epidermidis RP62A plasmid pSERP, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcggtcatttctctag Protospacer
. * *..***********. *********** .
495. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039187 (Piscirickettsia salmonis strain Psal-159 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
496. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038948 (Piscirickettsia salmonis strain Psal-028 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
497. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038933 (Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
498. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038973 (Piscirickettsia salmonis strain Psal-069 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
499. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP043848 (Staphylococcus epidermidis strain NCCP 16828 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
agattgatttttacttcttttctcatttcttttt Protospacer
. .* ****** ******** ********.*.
500. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039036 (Piscirickettsia salmonis strain Psal-071 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
501. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039066 (Piscirickettsia salmonis strain Psal-107 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
502. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038887 (Piscirickettsia salmonis strain Psal-004 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
503. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP039215 (Piscirickettsia salmonis strain Psal-104a plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
504. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_013372 (Staphylococcus epidermidis plasmid SAP016A, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcggtcatttctctag Protospacer
. * *..***********. *********** .
505. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038938 (Piscirickettsia salmonis strain Psal-026 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
506. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038963 (Piscirickettsia salmonis strain Psal-051 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
507. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NC_017350 (Staphylococcus aureus subsp. aureus 11819-97 plasmid p11819-97, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatagtgctttttcttcttcagtcatttctctag Protospacer
. * *..***********. *********** .
508. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038877 (Piscirickettsia salmonis strain Psal-002 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
509. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP038882 (Piscirickettsia salmonis strain Psal-003 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
attattattttttgttcttgtgtcatttactaaa Protospacer
..* ********* ***** ******** .. *
510. spacer 2.51|1027703|36|NZ_LN831027|CRISPRCasFinder,CRT matches to MT002873 (Tenacibaculum phage JQ, complete genome) position: , mismatch: 10, identity: 0.722
cccttataagtagcaaattcttttgtaaaactttct CRISPR spacer
tttttataagtagcaaagtcttttataaactctacc Protospacer
...************** ******.**** ..* *.
511. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 11, identity: 0.676
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
tgatttaatatttcttcttttgtcatttgatacg Protospacer
.*** * ****************** . *.
512. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to KT997873 (Uncultured Mediterranean phage uvDeep-CGR2-KM21-C368, complete genome) position: , mismatch: 11, identity: 0.676
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
aatgctagtttttcttcttttgtcatatcaaaag Protospacer
. * .** ****************** ** .
513. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to KU878088 (Bacillus phage AR9, complete genome) position: , mismatch: 11, identity: 0.676
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
tcaaatattctttcttcttttgtcatatcaaagg Protospacer
* ****.**************** ** .
514. spacer 2.43|1027178|34|NZ_LN831027|CRISPRCasFinder,CRT matches to MF360957 (Bacillus virus PBS1, complete genome) position: , mismatch: 11, identity: 0.676
gctcttattttttcttcttttgtcatttctctca CRISPR spacer
tcaaatattctttcttcttttgtcatatcaaagg Protospacer
* ****.**************** ** .
