Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013748 Pseudarthrobacter sulfonivorans strain Ar51 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP013747 Pseudarthrobacter sulfonivorans strain Ar51 chromosome, complete genome 4 crisprs csa3,DinG,cas3,DEDDh,PD-DExK,WYL,RT 0 1 2 0

Results visualization

1. NZ_CP013747
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013747_1 744977-745078 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013747_2 777176-777261 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013747_3 2880991-2881094 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013747_4 3290708-3291012 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013747_4 4.3|3290881|30|NZ_CP013747|CRT 3290881-3290910 30 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 63486-63515 6 0.8
NZ_CP013747_4 4.3|3290881|30|NZ_CP013747|CRT 3290881-3290910 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1803351-1803380 7 0.767
NZ_CP013747_4 4.3|3290881|30|NZ_CP013747|CRT 3290881-3290910 30 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 319271-319300 7 0.767
NZ_CP013747_4 4.3|3290881|30|NZ_CP013747|CRT 3290881-3290910 30 MN369765 Microbacterium phage Zanella, complete genome 10161-10190 7 0.767

1. spacer 4.3|3290881|30|NZ_CP013747|CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 6, identity: 0.8

tgcgcccgatccgaccaccgaccctgcgcc	CRISPR spacer
tgcgcccggtgcgaccaccgaccacgccgc	Protospacer
********.* ************ .**  *

2. spacer 4.3|3290881|30|NZ_CP013747|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767

tgcgcccgatccgaccaccgaccctgcgcc	CRISPR spacer
ggcccccgatccgacccccgacccgacccg	Protospacer
 ** ************ ******* .* * 

3. spacer 4.3|3290881|30|NZ_CP013747|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

tgcgcccgatccgaccaccg-accctgcgcc	CRISPR spacer
tgcgcccgatccgaacaccgaaaacagcag-	Protospacer
************** ***** *  * **.  

4. spacer 4.3|3290881|30|NZ_CP013747|CRT matches to MN369765 (Microbacterium phage Zanella, complete genome) position: , mismatch: 7, identity: 0.767

tgcgcccgatccgaccaccgaccctgcgcc	CRISPR spacer
cgcggccgatccgaccaccgacgacgcggg	Protospacer
.*** *****************  .***  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4326630 : 4374801 57 Arthrobacter_phage(27.78%) tail,portal,integrase,protease,capsid,head attL 4325482:4325521|attR 4327610:4327649
DBSCAN-SWA_2 4955993 : 5022918 46 Staphylococcus_phage(40.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage