Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008871 Pseudomonas aeruginosa strain W45909 chromosome, complete genome 3 crisprs csa3,RT,DEDDh,cas3,PD-DExK,DinG,WYL 2 0 7 3

Results visualization

1. NZ_CP008871
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008871_1 342356-342469 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008871_2 3115036-3115249 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008871_3 6701141-6701298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP008871_2 2.1|3115089|38|NZ_CP008871|PILER-CR 3115089-3115126 38 NZ_CP008871.2 3115365-3115402 1 0.974
NZ_CP008871_2 2.2|3115180|50|NZ_CP008871|PILER-CR 3115180-3115229 50 NZ_CP008871.2 3115250-3115299 1 0.98
NZ_CP008871_2 2.1|3115089|38|NZ_CP008871|PILER-CR 3115089-3115126 38 NZ_CP008871.2 3115262-3115299 2 0.947

1. spacer 2.1|3115089|38|NZ_CP008871|PILER-CR matches to position: 3115365-3115402, mismatch: 1, identity: 0.974

ggtaccggtgcgctggcggatagcgccggggcgctatt	CRISPR spacer
ggtgccggtgcgctggcggatagcgccggggcgctatt	Protospacer
***.**********************************

2. spacer 2.2|3115180|50|NZ_CP008871|PILER-CR matches to position: 3115250-3115299, mismatch: 1, identity: 0.98

tccgccgggtggggtaccggtgcgttggcggatagcgccggggcgctatt	CRISPR spacer
tccgccgggtggggtaccggtgcgttggcggatagcgctggggcgctatt	Protospacer
**************************************.***********

3. spacer 2.1|3115089|38|NZ_CP008871|PILER-CR matches to position: 3115262-3115299, mismatch: 2, identity: 0.947

ggtaccggtgcgctggcggatagcgccggggcgctatt	CRISPR spacer
ggtaccggtgcgttggcggatagcgctggggcgctatt	Protospacer
************.*************.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 638617 : 696140 58 Pseudomonas_phage(55.56%) tail,holin,tRNA NA
DBSCAN-SWA_2 1473420 : 1536350 77 Pseudomonas_phage(76.19%) terminase,holin,protease,lysis,tRNA,portal,integrase attL 1492843:1492865|attR 1533349:1533371
DBSCAN-SWA_3 2602257 : 2609150 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_4 3031801 : 3071162 33 Planktothrix_phage(33.33%) tail,plate NA
DBSCAN-SWA_5 5005881 : 5095901 102 Pseudomonas_virus(70.21%) terminase,integrase,head,holin,protease,tail,portal,capsid,plate,tRNA attL 5029381:5029397|attR 5094281:5094297
DBSCAN-SWA_6 5165726 : 5207385 40 Cyanophage(12.5%) protease,transposase NA
DBSCAN-SWA_7 6227561 : 6318050 99 Pseudomonas_virus(76.09%) terminase,head,holin,protease,tRNA,tail,transposase,portal,capsid,plate,integrase attL 6277736:6277751|attR 6322037:6322052
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP008871.2|WP_003158163.1|4750653_4751028_+|hypothetical-protein 4750653_4751028_+ 124 aa aa 27 NA NA No NA
NZ_CP008871.2|WP_021205795.1|4752769_4753162_+|hypothetical-protein 4752769_4753162_+ 130 aa aa 3 NA NA No NA
NZ_CP008871.2|WP_003158159.1|4753180_4753504_+|hypothetical-protein 4753180_4753504_+ 107 aa aa 15 NA NA No NA