Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013217 Kurthia sp. 11kri321, complete genome 4 crisprs RT,WYL,DEDDh,cas3,csa3,cas2,cas1,cas4,cas5,cas7,cas6,DinG 0 2 4 0

Results visualization

1. NZ_CP013217
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013217_1 467307-467464 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013217_2 1714286-1716211 Unclear NA
29 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013217_3 2118299-2118385 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013217_4 2423026-2423122 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013217_2 2.3|1714446|34|NZ_CP013217|CRISPRCasFinder,CRT 1714446-1714479 34 KP063118 Proteus phage pPM_01, complete genome 58510-58543 8 0.765
NZ_CP013217_2 2.32|1714447|34|NZ_CP013217|PILER-CR 1714447-1714480 34 KP063118 Proteus phage pPM_01, complete genome 58510-58543 8 0.765
NZ_CP013217_2 2.3|1714446|34|NZ_CP013217|CRISPRCasFinder,CRT 1714446-1714479 34 NC_031059 Rhodovulum phage vB_RhkS_P1, complete genome 16299-16332 9 0.735
NZ_CP013217_2 2.32|1714447|34|NZ_CP013217|PILER-CR 1714447-1714480 34 NC_031059 Rhodovulum phage vB_RhkS_P1, complete genome 16299-16332 9 0.735

1. spacer 2.3|1714446|34|NZ_CP013217|CRISPRCasFinder,CRT matches to KP063118 (Proteus phage pPM_01, complete genome) position: , mismatch: 8, identity: 0.765

ctcgaagtatcagactatgacgatgatgacgacg	CRISPR spacer
tcggacgagtcagactttgacgatgatgaagacg	Protospacer
.. ** * .******* ************ ****

2. spacer 2.32|1714447|34|NZ_CP013217|PILER-CR matches to KP063118 (Proteus phage pPM_01, complete genome) position: , mismatch: 8, identity: 0.765

ctcgaagtatcagactatgacgatgatgacgacg	CRISPR spacer
tcggacgagtcagactttgacgatgatgaagacg	Protospacer
.. ** * .******* ************ ****

3. spacer 2.3|1714446|34|NZ_CP013217|CRISPRCasFinder,CRT matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 9, identity: 0.735

ctcgaagtatcagactatgacgatgatgacgacg	CRISPR spacer
tgggctgcggcagacgatgacgatgatgacgacg	Protospacer
.  *  *.. ***** ******************

4. spacer 2.32|1714447|34|NZ_CP013217|PILER-CR matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 9, identity: 0.735

ctcgaagtatcagactatgacgatgatgacgacg	CRISPR spacer
tgggctgcggcagacgatgacgatgatgacgacg	Protospacer
.  *  *.. ***** ******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 362890 : 371211 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 1143243 : 1153554 22 Listeria_phage(20.0%) NA NA
DBSCAN-SWA_3 1158573 : 1174093 20 Bacillus_phage(27.27%) capsid,portal,head,tail,terminase NA
DBSCAN-SWA_4 2924711 : 2932291 7 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage