Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014144 Streptococcus salivarius strain JF, complete genome 4 crisprs csa3,DinG,WYL,cas3,DEDDh 0 1 5 0

Results visualization

1. NZ_CP014144
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014144_1 210084-210177 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014144_2 833837-833908 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014144_3 1437262-1437368 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014144_4 1640984-1641061 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014144_2 2.1|833860|26|NZ_CP014144|CRISPRCasFinder 833860-833885 26 MK448979 Streptococcus phage Javan534, complete genome 13403-13428 0 1.0
NZ_CP014144_2 2.1|833860|26|NZ_CP014144|CRISPRCasFinder 833860-833885 26 MK448799 Streptococcus phage Javan535, complete genome 13403-13428 0 1.0
NZ_CP014144_2 2.1|833860|26|NZ_CP014144|CRISPRCasFinder 833860-833885 26 MK448800 Streptococcus phage Javan539, complete genome 13404-13429 0 1.0
NZ_CP014144_2 2.1|833860|26|NZ_CP014144|CRISPRCasFinder 833860-833885 26 NZ_CP022370 Bosea sp. AS-1 plasmid unnamed1, complete sequence 112477-112502 6 0.769

1. spacer 2.1|833860|26|NZ_CP014144|CRISPRCasFinder matches to MK448979 (Streptococcus phage Javan534, complete genome) position: , mismatch: 0, identity: 1.0

ttgtccctagagacacctcagggaca	CRISPR spacer
ttgtccctagagacacctcagggaca	Protospacer
**************************

2. spacer 2.1|833860|26|NZ_CP014144|CRISPRCasFinder matches to MK448799 (Streptococcus phage Javan535, complete genome) position: , mismatch: 0, identity: 1.0

ttgtccctagagacacctcagggaca	CRISPR spacer
ttgtccctagagacacctcagggaca	Protospacer
**************************

3. spacer 2.1|833860|26|NZ_CP014144|CRISPRCasFinder matches to MK448800 (Streptococcus phage Javan539, complete genome) position: , mismatch: 0, identity: 1.0

ttgtccctagagacacctcagggaca	CRISPR spacer
ttgtccctagagacacctcagggaca	Protospacer
**************************

4. spacer 2.1|833860|26|NZ_CP014144|CRISPRCasFinder matches to NZ_CP022370 (Bosea sp. AS-1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769

ttgtccctagagacacctcagggaca	CRISPR spacer
cgccgcctagaggcacctcagggaca	Protospacer
.  . *******.*************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 326862 : 332344 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 774909 : 850466 82 Streptococcus_phage(76.79%) capsid,tail,protease,holin,integrase,terminase,portal attL 806415:806458|attR 847345:847388
DBSCAN-SWA_3 1145691 : 1156355 11 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_4 1921279 : 1971294 45 Lactococcus_phage(25.0%) transposase,tRNA,protease,bacteriocin NA
DBSCAN-SWA_5 2030769 : 2042200 12 Streptococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage