1. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 7.1|1577368|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 7.1|1577368|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 7.1|1577368|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 7.1|1577368|22|NZ_CP010337|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 6.2|1576443|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
9. spacer 6.2|1576443|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 6.2|1576443|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 6.2|1576443|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 6.2|1576443|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 6.3|1576497|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
14. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
15. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
16. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
18. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
24. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
25. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
26. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
27. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
28. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
30. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
31. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
32. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
33. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
34. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
35. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
36. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
37. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
38. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
41. spacer 6.4|1576551|22|NZ_CP010337|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
42. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
43. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
44. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
45. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
46. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
47. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
48. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
49. spacer 7.1|1577368|22|NZ_CP010337|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
50. spacer 8.5|2091245|24|NZ_CP010337|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
51. spacer 8.5|2091245|24|NZ_CP010337|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
52. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
gcggcggggccaacttcaacggcgg CRISPR spacer
tcggcggcgccaacctcaacggcgg Protospacer
****** ******.**********
53. spacer 3.1|369562|27|NZ_CP010337|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
54. spacer 3.1|369562|27|NZ_CP010337|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
55. spacer 3.7|369958|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
56. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
57. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
58. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
59. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
60. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
61. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
62. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
63. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
64. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
65. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
66. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
67. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
68. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
69. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
70. spacer 8.5|2091245|24|NZ_CP010337|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
71. spacer 8.5|2091245|24|NZ_CP010337|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
72. spacer 8.5|2091245|24|NZ_CP010337|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
73. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
tgggcgccgccaacttcaacggcgg Protospacer
**** *****************
74. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
agggcggcgccaacttcagcggcgg Protospacer
. ***** **********.******
75. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
cgggcggggtcaacatcaacggcgg Protospacer
*******.**** **********
76. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP051473 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
caggcggggacaacttcaacggcag Protospacer
******* *************.*
77. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP012967 (Rhodobacter sphaeroides strain MBTLJ-8 plasmid unnamed) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
caggcggggacaacttcaacggcag Protospacer
******* *************.*
78. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP030276 (Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
caggcggggacaacttcaacggcag Protospacer
******* *************.*
79. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP015289 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
caggcggggacaacttcaacggcag Protospacer
******* *************.*
80. spacer 14.10|3939721|25|NZ_CP010337|CRT matches to NZ_CP015212 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence) position: , mismatch: 4, identity: 0.84
gcggcggggccaacttcaacggcgg CRISPR spacer
caggcggggacaacttcaacggcag Protospacer
******* *************.*
81. spacer 3.1|369562|27|NZ_CP010337|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
82. spacer 3.1|369562|27|NZ_CP010337|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
83. spacer 3.7|369958|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
84. spacer 3.7|369958|27|NZ_CP010337|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
85. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
86. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
87. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
88. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
89. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
90. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
91. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
92. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
93. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
94. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
95. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
96. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
97. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
98. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
99. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
100. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
101. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
102. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
103. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
104. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
105. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
106. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
107. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
108. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
109. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
110. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
111. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
112. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
113. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
114. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
115. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
116. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
117. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
118. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
119. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
120. spacer 6.5|1576605|25|NZ_CP010337|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
121. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
122. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
123. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
124. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
125. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.839
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcagcgccaccggcggggccggcggcgactc Protospacer
. .*** *****************.******
126. spacer 3.1|369562|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
127. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
128. spacer 3.7|369958|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
129. spacer 3.9|370108|27|NZ_CP010337|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
130. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
131. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
132. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
133. spacer 3.10|370168|27|NZ_CP010337|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
134. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
135. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
136. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
137. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
138. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
139. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
140. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
141. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.824
gcggcggggccggcggtagcggcggggccaactt-- CRISPR spacer
gcggcgcggccggcggcagcggc--ggccaacccgg Protospacer
****** *********.****** *******..
142. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.806
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgcggcaccggcgggaccggcggcgtgtc Protospacer
*. **************.******.** **
143. spacer 3.4|369757|27|NZ_CP010337|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
144. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
145. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
146. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
147. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
148. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
149. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
150. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
151. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
152. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
153. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
154. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
155. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
156. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
157. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
158. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
159. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
160. spacer 6.1|1576383|28|NZ_CP010337|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
161. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
162. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
163. spacer 8.3|2091155|30|NZ_CP010337|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
164. spacer 8.3|2091155|30|NZ_CP010337|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
165. spacer 8.3|2091155|30|NZ_CP010337|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
166. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
167. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
168. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
169. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggggccggcggtagcggcggcgcaggcgc Protospacer
.************************ ** ..* .
170. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gtggcggggcgggcggtagcggcggcgccgtcac Protospacer
*.******** ************** ***. * .
171. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggggacggcggcagcggcggcgggctctt Protospacer
********* ******.******** * ***
172. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
173. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
174. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
175. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
176. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
177. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
178. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
179. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
180. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
gcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
******* *.*************** **.*.*
181. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.794
gcggcggggccggcggtagcggcg----gggccaactt CRISPR spacer
gcggcggtgccggcggcagcggcgagcagggcga---- Protospacer
******* ********.******* **** *
182. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggccccggcggtgccggcgataccga Protospacer
******** ******* ********.. *
183. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggcgccggcggggccggcggcgggac Protospacer
. ******.***************.**. *
184. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtgacggcaccggcggtgccggcggcgatgc Protospacer
. *.************ *******.***. *
185. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcg-gcaccggcggggccggcgacgactc CRISPR spacer
-tgccgcgcaccgggggggacggcgacgacgg Protospacer
* ** ******* **** **********
186. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tacccggcaccgccgaggccggcgacgagtt Protospacer
* ******** **.************ *.
187. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggcacgggcggggccggcggcagcac Protospacer
. ******** *************.*..* *
188. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgccgcgccggcggggccggcgaccgctt Protospacer
*. ** **.***************** .**.
189. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcgacgacaccggcgaggccggcgacgccgc Protospacer
*.**.********.*********** * *
190. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgccgcaacggcggggccggcgaccgctt Protospacer
*. ** *** **************** .**.
191. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agcgccgcaacggcggggccggcgaccgctt Protospacer
*. ** *** **************** .**.
192. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 7, identity: 0.774
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgtcggcaccggcggcgccggcggcggcaa Protospacer
* * ************ *******.**.*
193. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
194. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
195. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
196. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
197. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
198. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
199. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
200. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
201. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
202. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
203. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
204. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
205. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
206. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
207. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
208. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
209. spacer 8.3|2091155|30|NZ_CP010337|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
210. spacer 8.3|2091155|30|NZ_CP010337|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
211. spacer 11.25|3129200|29|NZ_CP010337|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
212. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
213. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
214. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
215. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
216. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
217. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
218. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
219. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
220. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
221. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
222. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
223. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
224. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
225. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
226. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
227. spacer 12.7|3746171|31|NZ_CP010337|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
228. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggggccggcgggaccggcggggccggggg Protospacer
*************** * **********..
229. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 8, identity: 0.765
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggcgccggcggtaacggcggcgtgggcat Protospacer
******* **********.****** *. ..* *
230. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gccgcggcaccggcggggccgccgccgatca Protospacer
. ****************** ** ***..
231. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
232. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
233. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
234. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
235. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
236. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
237. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
238. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
caggcggcgccggcgaggccggcgaggggca Protospacer
*******.******.********* *. .
239. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
240. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
241. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
242. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
243. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggccggcaccggcgtggccggcgacttcga Protospacer
.* *********** ********** *
244. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
245. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcggtgacggcggaaccgg Protospacer
**************** * *****. . *
246. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcggcggcgccggtggggccggcgaagcggc Protospacer
******.****.*********** * *
247. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gggaccgccccggcgggaccggcgacgacga Protospacer
..*.* ** ********.***********
248. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgtcggccccgtcggggccggcgacgcgga Protospacer
* * **** *** **************
249. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgac---gactc CRISPR spacer
cgcgcggcaccggcgaggccgtcgacctgga--- Protospacer
. ************.***** **** **
250. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ctgcgggcaccggcgcggccggcgccgaatt Protospacer
* ********** ******** *** *.
251. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP017564 (Paraburkholderia sprentiae WSM5005 plasmid pl3WSM5005, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggaaccggcgcggccggcgaagccgg Protospacer
. ***** ******* ********* * *
252. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcgtcgggaccggcggggcgggcgacggcga Protospacer
* *** *********** *******.*
253. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ttgcgggcaccggcgcggccggcgccgaatt Protospacer
* ********** ******** *** *.
254. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 8, identity: 0.742
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
acgtcggcaccggcggcgccggcggcgcgaa Protospacer
* * ************ *******.**
255. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
256. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
257. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
258. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
259. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
260. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
261. spacer 4.1|694013|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
262. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
263. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
264. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
265. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
266. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
267. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
268. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
269. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
270. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
271. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
272. spacer 12.9|3746303|37|NZ_CP010337|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757
cttgccggcggtgccggcgaccgcggtgccgccggcg CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc Protospacer
* ************ **********.***.* *
273. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gtggcggggccggcggcaccggcgggatcttcgg Protospacer
*.**************.* *******..* *
274. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcgggtccggcggtaacggcggtttcttcac Protospacer
******** *********.****** .* * .
275. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
gcggcggggacggcggcagcggcgtgcagcgctg Protospacer
********* ******.******* * .**
276. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcggggccggcggcggcggcgggatcgcctc Protospacer
**************..********..*. **.
277. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggcgccggcggtagtggcggaaccgaagg Protospacer
****** ***********.*****..**.*
278. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcggggccggcggcggcggcgggatcgcctc Protospacer
**************..********..*. **.
279. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_011893 (Methylobacterium nodulans ORS 2060 plasmid pMNOD03, complete sequence) position: , mismatch: 9, identity: 0.735
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggggccggcgggggcggcggcggcggcgg Protospacer
.*************** .******* * *..*
280. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcggcggcaccggcgggaccggcggcagggt Protospacer
. ***************.******.*.. .
281. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcatccgcagcggcggggccggcgaggaccg Protospacer
. * *** *************** ***.
282. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgggcggcaacggcggggccggcggtagcgg Protospacer
.******* **************....*
283. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
284. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgcgcggcaccggctggtccggcgacgcgcg Protospacer
. *********** ** ********* .
285. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaatgacaccggcgcggccggcgacgacga Protospacer
....*.******** *************
286. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgggcggcagcggcggggccggcggacaagg Protospacer
.******* **************. *
287. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tgaccggcaccggcagggctggcgacgagca Protospacer
.. **********.****.******** .
288. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tgaccggcaccggcagggctggcgacgagca Protospacer
.. **********.****.******** .
289. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gttcccgcacccgcggggcccgcgacgaccg Protospacer
. * ***** ******** ********.
290. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtccggccccggcggggccggagacgggtt Protospacer
.. **** ************* ****. *.
291. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ctgcgggcaccggcgcggccggcgccgaact Protospacer
* ********** ******** *** ..
292. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
aaggcggcaccggcgcgtccggccagcgtga Protospacer
*************** * ***** * ..
293. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcggcggcaccagcggtgccggcgaggcgcg Protospacer
*********.**** ******** * .
294. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccgcgggcaccggcgcggccggcgccgaact Protospacer
* ********** ******** *** ..
295. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
tcggcggcaccagcggtgccggcgaggcgcg Protospacer
*********.**** ******** * .
296. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccggcggcaccggcggtggcggcgaggcact Protospacer
************** * ****** * ..
297. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
ctgcgggcaccggcgcggccggcgccgaact Protospacer
* ********** ******** *** ..
298. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
299. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
300. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
301. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
302. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
303. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
304. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
305. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
306. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
307. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
308. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
309. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
310. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
311. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
312. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 9, identity: 0.71
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gaggcggcaccggcggcggcggcggtgcggt Protospacer
.*************** * *****..* .
313. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
314. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
315. spacer 3.6|369892|33|NZ_CP010337|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
316. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
317. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
318. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
319. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
320. spacer 6.10|1576997|31|NZ_CP010337|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
321. spacer 10.9|3126450|35|NZ_CP010337|PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
322. spacer 10.20|3126449|35|NZ_CP010337|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
323. spacer 10.29|3126229|34|NZ_CP010337|CRT matches to NZ_CP017280 (Enterobacter ludwigii strain EN-119 plasmid pEN-119, complete sequence) position: , mismatch: 10, identity: 0.706
acctgatagaagccggaaagctccgtgccgtcag CRISPR spacer
tcgctcagggagctggaaagctcggtgccgtcag Protospacer
* . .*.***.********* **********
324. spacer 11.21|3130001|34|NZ_CP010337|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
325. spacer 11.36|3130005|34|NZ_CP010337|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
326. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
327. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
328. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
329. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
330. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcggagccggcggaagcggcggccacgccgg Protospacer
.******.******** ******** *. *
331. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctggcggggccggcggtagcggtggcgcgtcacc Protospacer
.********************.** ** ..
332. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctggcggggccggcggtagcggtggcgcgtcacc Protospacer
.********************.** ** ..
333. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
tcggcgcggccggcggtaccggcgggaagtatgg Protospacer
***** *********** *******. *.
334. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aaggcggggccggcgctcgcggcgggctgcacga Protospacer
. ************* * ******** . **
335. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ctagcaaggccggcggtagcggcggttccaaggc Protospacer
..**..****************** **** .
336. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
aaggcgggtccggcgctagcggcgggctgcacga Protospacer
. ****** ****** ********** . **
337. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 10, identity: 0.677
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcttcggcaccggcgggccgggcgacgcgct Protospacer
. ************* * ******* ..
338. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.677
aaggcggcaccggcggggccggcgacgactc CRISPR spacer
gtacgggcaccggcggggcgggcgccgaaag Protospacer
. . ************** **** ***
339. spacer 12.5|3746030|34|NZ_CP010337|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
340. spacer 12.9|3746303|37|NZ_CP010337|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.703
cttgccggcggtgccggcgaccgcggtgccgccggcg CRISPR spacer
gccgtgcacggcgccggcggccgcggtgccgccgctg Protospacer
..*. .***.*******.************** .*
341. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ccggcggggccggcggcaacggcggcatcgcacc Protospacer
***************.*.****** ..*. ..
342. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcgcgcccggcggtagcggcgggcgggccgc Protospacer
**** * ***************** . * .
343. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.676
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgggcgcgcccggcggtagcggcgggcgggccgc Protospacer
**** * ***************** . * .
344. spacer 14.6|3939424|34|NZ_CP010337|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 12, identity: 0.647
gcggcggggccggcggtagcggcggggccaactt CRISPR spacer
acggcgggcccggcggtaacggcggcagtggtga Protospacer
.******* *********.****** . ....
345. spacer 14.8|3939568|31|NZ_CP010337|CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 12, identity: 0.613
------aaggcggcaccggcggggccggcgacgactc CRISPR spacer
agttcaaggccggcaccgccggggccgcctt------ Protospacer
*.* ******** ******** *