Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP014945 Caldimicrobium thiodismutans strain TF1 5 crisprs cas3,cas4,Cas9_archaeal,csa3 0 1 1 0

Results visualization

1. NZ_AP014945
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014945_1 709332-709539 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014945_2 731389-732297 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014945_3 733049-733143 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014945_4 1054382-1054862 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014945_5 1570601-1570694 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP014945_2 2.8|731888|36|NZ_AP014945|PILER-CR,CRISPRCasFinder,CRT 731888-731923 36 MN693012 Marine virus AFVG_117M3, complete genome 34160-34195 8 0.778

1. spacer 2.8|731888|36|NZ_AP014945|PILER-CR,CRISPRCasFinder,CRT matches to MN693012 (Marine virus AFVG_117M3, complete genome) position: , mismatch: 8, identity: 0.778

agtaaactattttatcagaagatttttctagctttc	CRISPR spacer
acaaaacttttttatcagaagatttatctcgtgtta	Protospacer
*  ***** **************** *** *. ** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1571516 : 1582512 7 uncultured_Mediterranean_phage(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage