1. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545746 (Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
2. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545746 (Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
3. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545746 (Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
4. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664577 (Vibrio phage CTX transgenic isolate recombinant pCTX1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
5. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ434666 (Vibrio phage CTX RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
6. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664574 (Vibrio phage CTX transgenic isolate CTX-RS1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
7. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466611 (Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
8. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466611 (Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
9. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540271 (Vibrio phage CTX plasmid pCTX-5 Kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
10. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
11. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
12. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
13. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GU942563 (Vibrio phage CTX chromosome I prophage, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
14. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485654 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
15. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485654 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
16. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AB428550 (Vibrio phage CTX ctxB, hp1, rstR, rstA, and rstB genes for cholera toxin B subunit, hypothetical protein, transcriptional repressor RstR, RstA and RstB proteins, partial and complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
17. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KM352500 (Vibrio phage CTX strain 81, partial genome) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
18. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_015209 (Vibrio phage CTX chromosome I, complete genome) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
19. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_015209 (Vibrio phage CTX chromosome I, complete genome) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
20. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485650 (Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
21. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485650 (Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
22. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664572 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
23. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449748 (Vibrio phage CTX strain E1781 RstR (rstR) gene, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
24. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664580 (Vibrio phage CTX transgenic plasmid pCTX-1-1kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
25. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664575 (Vibrio phage CTX transgenic isolate recombinant CTX1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
26. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466609 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
27. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466609 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
28. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466610 (Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
29. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466610 (Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
30. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545745 (Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
31. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545745 (Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
32. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545745 (Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
33. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ499847 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), Ace (ace), ZOT (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds; and unknown gene) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
34. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to DQ012295 (Vibrio phage CTX CtxB (ctxB) gene, partial cds; RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
35. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485644 (Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
36. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485644 (Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
37. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449741 (Vibrio phage CTX strain 07.95vp CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
38. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664567 (Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
39. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664567 (Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
40. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449743 (Vibrio phage CTX strain MG116926 RstR (rstR) gene, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
41. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ619459 (Vibrio phage CTX, complete genome) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
42. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449744 (Vibrio phage CTX strain MG116926 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
43. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485653 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
44. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485653 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
45. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664568 (Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
46. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664568 (Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
47. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466612 (Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
48. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466612 (Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
49. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485649 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
50. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485649 (Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
51. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540270 (Vibrio phage CTX plasmid pCTX-3 Kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
52. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485646 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
53. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485646 (Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
54. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545744 (Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
55. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545744 (Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
56. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to JN545744 (Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
57. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MF155889 (Vibrio virus CTXphi, complete genome) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
58. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664579 (Vibrio phage CTX transgenic plasmid pCTX-1kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
59. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540269 (Vibrio phage CTX plasmid pCTX1*Kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
60. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485652 (Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
61. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485652 (Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
62. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449738 (Vibrio phage CTX strain 07.95vp RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
63. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485648 (Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
64. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485648 (Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
65. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449752 (Vibrio phage CTX strain IB4642 RstC (rstC) gene, partial cds; RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
66. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664578 (Vibrio phage CTX transgenic plasmid pCTX3 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
67. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664581 (Vibrio phage CTX transgenic plasmid pCTX-3kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
68. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449751 (Vibrio phage CTX strain IB4642 RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
69. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449747 (Vibrio phage CTX strain E1781 RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
70. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449749 (Vibrio phage CTX strain E1781 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
71. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664566 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
72. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664566 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
73. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664566 (Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
74. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KJ540272 (Vibrio phage CTX plasmid pCTX-6 Kan, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
75. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485651 (Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
76. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485651 (Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
77. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KT728931 (Vibrio phage pre-CTX, complete genome) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
78. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to HQ224500 (Vibrio phage CTX, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
79. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to HQ224500 (Vibrio phage CTX, complete sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
80. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485645 (Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
81. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485645 (Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
82. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ449746 (Vibrio phage CTX strain E1781 RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
83. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
84. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
85. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ466608 (Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
86. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485647 (Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
87. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to GQ485647 (Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
88. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to FJ434665 (Vibrio phage CTX RstR (rstR) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
89. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to KF664573 (Vibrio phage CTX transgenic isolate recombinant PM7 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
90. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AY145126 (Vibrio phage CTX RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds) position: , mismatch: 0, identity: 1.0
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacaa Protospacer
********************************
91. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN200778 (Vibrio phage VAI1, complete genome) position: , mismatch: 1, identity: 0.969
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacac Protospacer
*******************************
92. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN200777 (Vibrio phage VAI2, complete genome) position: , mismatch: 1, identity: 0.969
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgaatacac Protospacer
*******************************
93. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AF416590 (Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence) position: , mismatch: 1, identity: 0.969
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgctaatacaa Protospacer
************************ *******
94. spacer 2.7|860245|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 5, identity: 0.844
-tcggtcgcaggcttgctcccttatccctgcgg CRISPR spacer
agaggtcgc-ggcttgctcccttctccccgcgg Protospacer
****** ************* ****.****
95. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AF416590 (Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence) position: , mismatch: 5, identity: 0.844
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgattgcgaagtcct Protospacer
******************* ******* *
96. spacer 2.14|860665|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 6, identity: 0.812
tcgtaatccggttcacgtcgttcgacttcata- CRISPR spacer
tcgtcatcaggttcacgtcgttc-tcgacatag Protospacer
**** *** ************** * ****
97. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_001956 (Vibrio phage fs2, complete genome) position: , mismatch: 6, identity: 0.812
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgttacccc Protospacer
************************* *
98. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to AB002632 (Vibrio phage fs2 DNA, complete genome) position: , mismatch: 6, identity: 0.812
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactggcgcgctacgcttgcgttacccc Protospacer
************************* *
99. spacer 2.5|860125|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017104 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence) position: , mismatch: 8, identity: 0.75
cattgggttttgatgtagtcctgcaggtattt CRISPR spacer
ggttgggttttgaggtattcctgcaggaagcg Protospacer
.*********** *** ********* * .
100. spacer 2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN034288 (Leviviridae sp. isolate H4_Bulk_47_scaffold_485 RNA-dependent RNA polymerase (H4Bulk47485_000001) and hypothetical protein (H4Bulk47485_000002) genes, complete cds; and hypothetical protein (H4Bulk47485_000003) gene, partial cds) position: , mismatch: 8, identity: 0.75
atcgatacgcttggcaaccgttatgttgggct CRISPR spacer
atcgatacggttggcaaccgctagtttactcc Protospacer
********* **********.** **. *.
101. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY940428 (UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
102. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_014172 (Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
103. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
104. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
105. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
106. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
107. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
108. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_011655 (Bacillus cereus AH187 plasmid pAH187_270, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
109. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_010924 (Bacillus cereus strain AH187 plasmid pCER270, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
110. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to CP045776 (Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
111. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
112. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
113. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NC_016792 (Bacillus cereus NC7401 plasmid pNCcld, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
114. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040343 (Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
115. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033789 (Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
116. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
--ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
atgattacttgt--atatgtggaaaaaataaagt Protospacer
*..*** ..* **************.*****
117. spacer 2.4|860065|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MH460463 (Dickeya phage vB_DsoM_AD1, complete genome) position: , mismatch: 9, identity: 0.719
tttcaatcaccgtcaccacttcttttgattgc CRISPR spacer
tgatttgcaccgtggccacttcttttgatttc Protospacer
* . ****** .*************** *
118. spacer 2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to MN693807 (Marine virus AFVG_250M375, complete genome) position: , mismatch: 9, identity: 0.719
ggctacgcatggatatgtggaaaaaacaaagt CRISPR spacer
ggaactctttggatgtgtggaaaaaacaatgt Protospacer
** . . *****.************** **
119. spacer 2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
aaacgaatcaagtccgtcgccagcgacgaaaa CRISPR spacer
gcaagaatcaactccatcgccagcgacatccg Protospacer
. * ******* ***.***********. .
120. spacer 2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 10, identity: 0.688
atcgatacgcttggcaaccgttatgttgggct CRISPR spacer
gccgatgcgcttggcaacctttatgtctcagc Protospacer
..****.************ ******. . .
121. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028563 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence) position: , mismatch: 10, identity: 0.688
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
aaaaaactgccgcgctacgcttgccgcctccc Protospacer
*** **** ************** . . *
122. spacer 2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016173 (Bordetella flabilis strain AU10664 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
caaacactggcgcgctacgcttgcgaatacaa CRISPR spacer
caaacactgacgcgctccgcttgtcggcccct Protospacer
*********.****** ******. ... *
123. spacer 2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 11, identity: 0.656
aaacgaatcaagtccgtcgccagcgacgaaaa CRISPR spacer
ggtgccttcaagtccgtcgccggcggcgaact Protospacer
.. **************.***.****