Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014024 Providencia stuartii strain FDAARGOS_145 chromosome, complete genome 5 crisprs DEDDh,csa3,cas3,DinG,cas6f,cas7f,cas5f,cas8f,cas3-cas2,cas1,WYL,cas14j 0 15 291 0

Results visualization

1. NZ_CP014024
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014024_1 16433-16700 Orphan I-F
4 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014024_2 1446871-1447080 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014024_3 1468011-1468398 Orphan I-F
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014024_4 1541214-1542142 TypeI-F I-F
15 spacers
cas6f,cas7f,cas5f,cas8f,cas3-cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014024_5 1551109-1551513 TypeI-F I-F
6 spacers
cas1,cas3-cas2,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 MK047640 Phage NV18, complete genome 22715-22746 0 1.0
NZ_CP014024_1 1.1|16461|32|NZ_CP014024|PILER-CR,CRT 16461-16492 32 MW057855 Providencia phage PSTCR3, complete genome 12742-12773 1 0.969
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 KY420199 Proteus phage vB_PvuS_Pm34, complete genome 14221-14252 1 0.969
NZ_CP014024_4 4.1|1541242|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541242-1541273 32 NZ_CP017672 Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence 69860-69891 2 0.938
NZ_CP014024_3 3.2|1468099|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1468099-1468130 32 MW057855 Providencia phage PSTCR3, complete genome 7862-7893 3 0.906
NZ_CP014024_4 4.1|1541242|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541242-1541273 32 NZ_CP050151 Hafnia alvei strain A23BA plasmid pA23BA, complete sequence 59097-59128 3 0.906
NZ_CP014024_4 4.1|1541242|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541242-1541273 32 NZ_CP024167 Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_02, complete sequence 17832-17863 3 0.906
NZ_CP014024_2 2.6|1447018|32|NZ_CP014024|CRISPRCasFinder 1447018-1447049 32 NZ_CP054833 Staphylococcus saprophyticus strain UTI-045 plasmid pUTI-045-2, complete sequence 5037-5068 6 0.812
NZ_CP014024_2 2.6|1447018|32|NZ_CP014024|CRISPRCasFinder 1447018-1447049 32 NC_013349 Staphylococcus aureus plasmid SAP099B, complete sequence 5017-5048 6 0.812
NZ_CP014024_4 4.9|1541722|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541722-1541753 32 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 179441-179472 6 0.812
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 HQ906666 Wolbachia endosymbiont wVitB of Nasonia vitripennis phage WOVitB segment 2, partial genome 23266-23297 6 0.812
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 KX522565 Wolbachia phage WO, complete genome 28802-28833 6 0.812
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 HQ906662 Wolbachia endosymbiont wVitA of Nasonia vitripennis phage WOVitA1, complete sequence 53894-53925 6 0.812
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 891488-891519 7 0.781
NZ_CP014024_4 4.7|1541602|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541602-1541633 32 NZ_CP006906 Clostridium baratii str. Sullivan plasmid pCBJ, complete sequence 32507-32538 7 0.781
NZ_CP014024_4 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541662-1541693 32 NZ_CP013927 Alteromonas stellipolaris strain LMG 21861 plasmid pASTE61-200, complete sequence 58489-58520 7 0.781
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 NZ_CP013044 Clostridium perfringens strain JP55 plasmid pJFP55J, complete sequence 20654-20685 7 0.781
NZ_CP014024_3 3.5|1468279|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1468279-1468310 32 MK047642 Phage NG55, complete genome 13002-13033 8 0.75
NZ_CP014024_4 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1542083-1542114 32 KY979109 Salmonella phage SHP1, complete genome 29543-29574 8 0.75
NZ_CP014024_4 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1542083-1542114 32 NC_014260 Enterobacteria phage IME08, complete genome 47782-47813 8 0.75
NZ_CP014024_4 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1542083-1542114 32 HM071924 Enterobacteria phage IME08, complete sequence 47782-47813 8 0.75
NZ_CP014024_4 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1542083-1542114 32 MH051917 Enterobacteria phage vB_EcoM_IME341, complete genome 127953-127984 8 0.75
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 NC_019739 Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence 63427-63458 8 0.75
NZ_CP014024_5 5.3|1551274|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551274-1551305 32 NC_015250 Acinetobacter phage 133, complete genome 120243-120274 8 0.75
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 MN694485 Marine virus AFVG_250M19, complete genome 64045-64076 8 0.75
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 KC821618 Cellulophaga phage phi10:1, complete genome 45484-45515 8 0.75
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 GU943030 Uncultured phage MedDCM-OCT-S08-C151 genomic sequence 5435-5466 8 0.75
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 57068-57099 9 0.719
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 36877-36908 9 0.719
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 87929-87960 9 0.719
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 7366-7397 9 0.719
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 393223-393254 9 0.719
NZ_CP014024_2 2.6|1447018|32|NZ_CP014024|CRISPRCasFinder 1447018-1447049 32 NZ_CP011383 Calothrix sp. 336/3 plasmid unnamed1 68886-68917 9 0.719
NZ_CP014024_3 3.3|1468159|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1468159-1468190 32 NZ_CP041744 Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence 94851-94882 9 0.719
NZ_CP014024_4 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541662-1541693 32 NZ_CP024792 Nostoc flagelliforme CCNUN1 plasmid pNFSY07, complete sequence 127541-127572 9 0.719
NZ_CP014024_4 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541662-1541693 32 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 68904-68935 9 0.719
NZ_CP014024_4 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1541662-1541693 32 NZ_CP025811 Sulfitobacter sp. SK025 plasmid unnamed3, complete sequence 132444-132475 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MN693644 Marine virus AFVG_250M1161, complete genome 30248-30279 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 NZ_CP035561 Lactobacillus plantarum strain SRCM103297 plasmid unnamed5 23517-23548 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 JQ692107 Vibrio vulnificus phage SSP002, complete genome 46826-46857 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MN215888 Vibrio phage vB_VpaS_HCMJ, complete genome 46939-46970 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MF754116 Vibrio phage vB_VpaS_KF6, complete genome 45028-45059 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MF754115 Vibrio phage vB_VpaS_KF5, complete genome 46945-46976 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MN694432 Marine virus AFVG_250M20, complete genome 25511-25542 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MG602476 Vibrio phage VVP001, complete genome 28095-28126 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MN693757 Marine virus AFVG_250M21, complete genome 25568-25599 9 0.719
NZ_CP014024_5 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551214-1551245 32 MH925090 UNVERIFIED: Vibrio phage ValLY_3, complete genome 24370-24401 9 0.719
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 NC_049490 Acinetobacter phage vB_AbaP_Berthold, complete genome 69059-69090 9 0.719
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 MN709128 Acinetobacter phage Berthold, complete genome 69059-69090 9 0.719
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP031899 Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence 49007-49038 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 108904-108935 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 12197-12228 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 AP022645 Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence 61966-61997 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 113042-113073 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 43057-43088 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 108903-108934 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027375 Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence 85428-85459 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP028382 Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence 127938-127969 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027343 Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence 73040-73071 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027463 Escherichia coli isolate 07-4299 plasmid unnamed 42525-42556 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 64831-64862 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027585 Escherichia coli strain 00-3076 plasmid unnamed, complete sequence 40499-40530 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 43723-43754 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 69816-69847 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NC_007365 Escherichia coli EH41 plasmid pO113, complete sequence 133995-134026 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP023542 Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence 108908-108939 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP024291 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence 44736-44767 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP023164 Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence 11956-11987 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 CP027581 Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence 15986-16017 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 CP027673 Escherichia coli strain 2014C-3003 plasmid unnamed1 8319-8350 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP028611 Escherichia coli strain 142 plasmid pTA142-2, complete sequence 37860-37891 10 0.688
NZ_CP014024_3 3.1|1468039|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1468039-1468070 32 NC_021910 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetNIM1c, complete sequence 16309-16340 10 0.688
NZ_CP014024_3 3.1|1468039|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT 1468039-1468070 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 349138-349169 10 0.688
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 MT774383 CrAssphage cr11_1, complete genome 77996-78027 10 0.688
NZ_CP014024_5 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT 1551454-1551485 32 AP014284 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS *** 6648-6679 10 0.688
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP031899 Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence 136025-136056 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_KM085450 Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence 43603-43634 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_AP017613 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence 89084-89115 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NC_022996 Escherichia coli plasmid pO26-CRL-125, complete sequence 70040-70071 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NC_022992 Escherichia coli plasmid pO111-CRL-115, complete sequence 60459-60490 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP009107 Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence 43603-43634 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP028382 Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence 54277-54308 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP037942 Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence 154253-154284 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027381 Escherichia coli strain 2013C-3250 plasmid unnamed1 12148-12179 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 134732-134763 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 MN334219 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence 52369-52400 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 MN334220 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence 62419-62450 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_AP018803 Escherichia coli strain E2863 plasmid pE2863-1, complete sequence 67378-67409 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP040264 Escherichia coli strain 631 plasmid pEc631_1, complete sequence 39659-39690 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027600 Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence 20013-20044 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 160952-160983 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_LT985320 Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII 18058-18089 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027585 Escherichia coli strain 00-3076 plasmid unnamed, complete sequence 114175-114206 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NC_025138 Escherichia coli plasmid pH2332-107, complete sequence 35479-35510 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP013024 Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence 100738-100769 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 166451-166482 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027453 Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence 46421-46452 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027453 Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence 140754-140785 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 121250-121281 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 165936-165967 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP028120 Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence 40395-40426 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NC_007365 Escherichia coli EH41 plasmid pO113, complete sequence 54275-54306 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_CP023542 Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence 43608-43639 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_AP019762 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence 62237-62268 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 MN335638 Escherichia coli strain SFE199 plasmid pSFE199, complete sequence 60190-60221 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 MN335639 Escherichia coli strain SFE059 plasmid pSFE059, complete sequence 61672-61703 11 0.656
NZ_CP014024_1 1.2|16521|32|NZ_CP014024|PILER-CR,CRT 16521-16552 32 NZ_AP018797 Escherichia coli strain E2855 plasmid pE2855-1, complete sequence 68316-68347 11 0.656

1. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MK047640 (Phage NV18, complete genome) position: , mismatch: 0, identity: 1.0 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
ctttttattctgatggatataaatcattaaca	Protospacer
********************************

2. spacer 1.1|16461|32|NZ_CP014024|PILER-CR,CRT matches to MW057855 (Providencia phage PSTCR3, complete genome) position: , mismatch: 1, identity: 0.969 

tatatcgaaaccggctatgtagttattggata	CRISPR spacer
tatatcgaagccggctatgtagttattggata	Protospacer
*********.**********************

3. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to KY420199 (Proteus phage vB_PvuS_Pm34, complete genome) position: , mismatch: 1, identity: 0.969 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
ctttttattccgatggatataaatcattaaca	Protospacer
**********.*********************

4. spacer 4.1|1541242|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 2, identity: 0.938 

agtggtggcaaccaactaaagccaacttcttt	CRISPR spacer
agtggtggcagccaacaaaagccaacttcttt	Protospacer
**********.***** ***************

5. spacer 3.2|1468099|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to MW057855 (Providencia phage PSTCR3, complete genome) position: , mismatch: 3, identity: 0.906 

cagttacttctggcattttctgattttccaga	CRISPR spacer
cggtcacttctggcattttctggttttccaga	Protospacer
*.**.*****************.*********

6. spacer 4.1|1541242|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050151 (Hafnia alvei strain A23BA plasmid pA23BA, complete sequence) position: , mismatch: 3, identity: 0.906 

agtggtggcaaccaactaaagccaacttcttt	CRISPR spacer
actggtggcaaccgacgaaagccaacttcttt	Protospacer
* ***********.** ***************

7. spacer 4.1|1541242|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024167 (Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_02, complete sequence) position: , mismatch: 3, identity: 0.906 

agtggtggcaaccaactaaagccaacttcttt	CRISPR spacer
actggtggcaaccgacgaaagccaacttcttt	Protospacer
* ***********.** ***************

8. spacer 2.6|1447018|32|NZ_CP014024|CRISPRCasFinder matches to NZ_CP054833 (Staphylococcus saprophyticus strain UTI-045 plasmid pUTI-045-2, complete sequence) position: , mismatch: 6, identity: 0.812 

tttacaagaatgtgattatatttcctttaaag---	CRISPR spacer
tttacaagaacgtgagtatatt---tttaaacatt	Protospacer
**********.**** ******   ******

9. spacer 2.6|1447018|32|NZ_CP014024|CRISPRCasFinder matches to NC_013349 (Staphylococcus aureus plasmid SAP099B, complete sequence) position: , mismatch: 6, identity: 0.812 

tttacaagaatgtgattatatttcctttaaag---	CRISPR spacer
tttacaagaacgtgagtatatt---tttaaacatt	Protospacer
**********.**** ******   ******

10. spacer 4.9|1541722|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 6, identity: 0.812 

aatgcgtttcatgctgacattaacagcgttag	CRISPR spacer
aatccgtttcatgatgacattaacagcttgtt	Protospacer
*** ********* ************* *

11. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to HQ906666 (Wolbachia endosymbiont wVitB of Nasonia vitripennis phage WOVitB segment 2, partial genome) position: , mismatch: 6, identity: 0.812 

gtcataaacttctttagctttcgcttgctctg-	CRISPR spacer
gagataaagttctttagcttttgctt-ttctgc	Protospacer
*  ***** ************.**** .****

12. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to KX522565 (Wolbachia phage WO, complete genome) position: , mismatch: 6, identity: 0.812 

gtcataaacttctttagctttcgcttgctctg-	CRISPR spacer
gagataaagttctttagcttttgctt-ttctgc	Protospacer
*  ***** ************.**** .****

13. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to HQ906662 (Wolbachia endosymbiont wVitA of Nasonia vitripennis phage WOVitA1, complete sequence) position: , mismatch: 6, identity: 0.812 

gtcataaacttctttagctttcgcttgctctg-	CRISPR spacer
gagataaagttctttagcttttgctt-ttctgc	Protospacer
*  ***** ************.**** .****

14. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
ctttagtaataacattctgcttatcaaagtca	Protospacer
 .. * *********.***.************

15. spacer 4.7|1541602|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006906 (Clostridium baratii str. Sullivan plasmid pCBJ, complete sequence) position: , mismatch: 7, identity: 0.781 

-tacaacgctgtgcaagacttctagttgcaatc	CRISPR spacer
gtactg-gatgtgcaagacttcttgttgtaata	Protospacer
 *** . * ************** ****.***

16. spacer 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013927 (Alteromonas stellipolaris strain LMG 21861 plasmid pASTE61-200, complete sequence) position: , mismatch: 7, identity: 0.781 

tcagcaagtagttctgcatgttc-tatgatgta	CRISPR spacer
tcagcaaataattctgcatgttcacttggttt-	Protospacer
*******.**.************ . **.* *

17. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP013044 (Clostridium perfringens strain JP55 plasmid pJFP55J, complete sequence) position: , mismatch: 7, identity: 0.781 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
ttttttattgtgatggataaaaataaattaaa	Protospacer
.******** ********* **** * * * *

18. spacer 3.5|1468279|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to MK047642 (Phage NG55, complete genome) position: , mismatch: 8, identity: 0.75 

actttttctctcagtagacacagcaagtgtta	CRISPR spacer
tacttgactctcagttgacacagcaaatgttt	Protospacer
  .**  ******** **********.****

19. spacer 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to KY979109 (Salmonella phage SHP1, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaagccagacaagcacccggtgctaaaaa	CRISPR spacer
cctaaagccagacgagcacccagtgctagtaa	Protospacer
    *********.*******.******. **

20. spacer 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NC_014260 (Enterobacteria phage IME08, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaagccagacaagcacccggtgctaaaaa	CRISPR spacer
cctaaagccagacgagcacccagtgctagtaa	Protospacer
    *********.*******.******. **

21. spacer 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to HM071924 (Enterobacteria phage IME08, complete sequence) position: , mismatch: 8, identity: 0.75 

aaacaagccagacaagcacccggtgctaaaaa	CRISPR spacer
cctaaagccagacgagcacccagtgctagtaa	Protospacer
    *********.*******.******. **

22. spacer 4.15|1542083|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to MH051917 (Enterobacteria phage vB_EcoM_IME341, complete genome) position: , mismatch: 8, identity: 0.75 

aaacaagccagacaagcacccggtgctaaaaa	CRISPR spacer
cctaaagccagacgagcacccagtgctagtaa	Protospacer
    *********.*******.******. **

23. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
aacttaaactgttttagctttcgcttggggtg	Protospacer
. * ****** .***************   **

24. spacer 5.3|1551274|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to NC_015250 (Acinetobacter phage 133, complete genome) position: , mismatch: 8, identity: 0.75 

aaaagatgacaatgataaatgcca---tgtttgca	CRISPR spacer
caaagatgacaatgatgaatggcaacctattc---	Protospacer
 ***************.**** **   *.**.

25. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MN694485 (Marine virus AFVG_250M19, complete genome) position: , mismatch: 8, identity: 0.75 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
ctttttattatgatggaaataaatttatgagg	Protospacer
********* ******* ******.  *.* .

26. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to KC821618 (Cellulophaga phage phi10:1, complete genome) position: , mismatch: 8, identity: 0.75 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
acgtttatgttgatggatataaatcatataga	Protospacer
 . ***** .*****************  * *

27. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to GU943030 (Uncultured phage MedDCM-OCT-S08-C151 genomic sequence) position: , mismatch: 8, identity: 0.75 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
atgttaattctgatgaatataaatcagcagta	Protospacer
 * ** *********.********** .*..*

28. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 9, identity: 0.719 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
agggagtaataatatcctgtttattaaagggc	Protospacer
*  .* ******.***********.****

29. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 9, identity: 0.719 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
agggagtaataatatcctgtttattaaagggc	Protospacer
*  .* ******.***********.****

30. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 9, identity: 0.719 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
agggagtaataatatcctgtttattaaagggc	Protospacer
*  .* ******.***********.****

31. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
cataactaataatatcctgtttatcataaaga	Protospacer
  .**.******.************* *.  *

32. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
cataactaataatatcctgtttatcataaaga	Protospacer
  .**.******.************* *.  *

33. spacer 2.6|1447018|32|NZ_CP014024|CRISPRCasFinder matches to NZ_CP011383 (Calothrix sp. 336/3 plasmid unnamed1) position: , mismatch: 9, identity: 0.719 

tttacaagaatgtgattatatttcctttaaag	CRISPR spacer
tttacaagcatgtgaatatatttcatgattgc	Protospacer
******** ****** ******** *    .

34. spacer 3.3|1468159|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041744 (Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

cacaattagtgaacctgaatggtcaacatggc	CRISPR spacer
cctgaccagtgaacctgaatggtgaacttgaa	Protospacer
* ..*..**************** *** **.

35. spacer 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024792 (Nostoc flagelliforme CCNUN1 plasmid pNFSY07, complete sequence) position: , mismatch: 9, identity: 0.719 

tcagcaagtagttctgcatgttctatgatgta	CRISPR spacer
gcagcaagtagttcagcattttcttgagggtt	Protospacer
 ************* **** ****  .. **

36. spacer 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 9, identity: 0.719 

tcagcaagtagttctgcatgttctatgatgta	CRISPR spacer
gcagcaagtagttcagcattttcttgagggtt	Protospacer
 ************* **** ****  .. **

37. spacer 4.8|1541662|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025811 (Sulfitobacter sp. SK025 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

tcagcaagtagttctgcatgttctatgatgta	CRISPR spacer
tcagcaagtcgttctgcatgctcatctcagca	Protospacer
********* **********.**  .   *.*

38. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MN693644 (Marine virus AFVG_250M1161, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
atcataaaattctttagctttagctgctaacg	Protospacer
.******* ************ ***  .  .*

39. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP035561 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed5) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
ggattaaacttcttaagctttcgcctgtttgt	Protospacer
*   ********** *********.**.*.

40. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to JQ692107 (Vibrio vulnificus phage SSP002, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
tgctttttcttctttagctggcgcttgctctt	Protospacer
  * *   ***********  **********

41. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MN215888 (Vibrio phage vB_VpaS_HCMJ, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
tgctttttcttctttagctggcgcttgctctt	Protospacer
  * *   ***********  **********

42. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MF754116 (Vibrio phage vB_VpaS_KF6, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
tgctttttcttctttagctggcgcttgctctt	Protospacer
  * *   ***********  **********

43. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MF754115 (Vibrio phage vB_VpaS_KF5, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
tgctttttcttctttagctggcgcttgctctt	Protospacer
  * *   ***********  **********

44. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MN694432 (Marine virus AFVG_250M20, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
ttcataaacttttttagctttagcaagtcttt	Protospacer
 **********.********* **  *...*

45. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MG602476 (Vibrio phage VVP001, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
tgctttttcttctttagctggcgcttgctctt	Protospacer
  * *   ***********  **********

46. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MN693757 (Marine virus AFVG_250M21, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
ttcataaacttttttagctttagcaagtcttt	Protospacer
 **********.********* **  *...*

47. spacer 5.2|1551214|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MH925090 (UNVERIFIED: Vibrio phage ValLY_3, complete genome) position: , mismatch: 9, identity: 0.719 

gtcataaacttctttagctttcgcttgctctg	CRISPR spacer
tgctttttcttctttagctggcgcttgctctt	Protospacer
  * *   ***********  **********

48. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to NC_049490 (Acinetobacter phage vB_AbaP_Berthold, complete genome) position: , mismatch: 9, identity: 0.719 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
agcgttcttctgatgaatataaatcatcttca	Protospacer
  . ** ********.***********.  **

49. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MN709128 (Acinetobacter phage Berthold, complete genome) position: , mismatch: 9, identity: 0.719 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
agcgttcttctgatgaatataaatcatcttca	Protospacer
  . ** ********.***********.  **

50. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

51. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

52. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

53. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to AP022645 (Bacillus wiedmannii PL1 plasmid pBwiPL1-2 DNA, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
gagaattaatatcatactgtttatcagtaata	Protospacer
.  ******** *** **********. . .*

54. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

55. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

56. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

57. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027375 (Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

58. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

59. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027343 (Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

60. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027463 (Escherichia coli isolate 07-4299 plasmid unnamed) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

61. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

62. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027585 (Escherichia coli strain 00-3076 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

63. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

64. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

65. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

66. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

67. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP024291 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

68. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP023164 (Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

69. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to CP027581 (Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

70. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to CP027673 (Escherichia coli strain 2014C-3003 plasmid unnamed1) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

71. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP028611 (Escherichia coli strain 142 plasmid pTA142-2, complete sequence) position: , mismatch: 10, identity: 0.688 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggagtaataatatcctgtttattaaagggc	Protospacer
   .* ******.***********.****

72. spacer 3.1|1468039|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NC_021910 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetNIM1c, complete sequence) position: , mismatch: 10, identity: 0.688 

gattacgctggcgaattgagcgcattgtcatt	CRISPR spacer
tatcacgctggcgaattcagcgcaaatttggg	Protospacer
 **.************* ******   *..

73. spacer 3.1|1468039|32|NZ_CP014024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 10, identity: 0.688 

gattacgctggcgaattgagcgcattgtcatt	CRISPR spacer
agttccgctggcgcattgagcgcatggaagcg	Protospacer
..** ******** *********** *  ..

74. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to MT774383 (CrAssphage cr11_1, complete genome) position: , mismatch: 10, identity: 0.688 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
ttacttatcctgatggttataaatcatggtgt	Protospacer
.* .****.******* ********** .

75. spacer 5.6|1551454|32|NZ_CP014024|CRISPRCasFinder,PILER-CR,CRT matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688 

ctttttattctgatggatataaatcattaaca	CRISPR spacer
tgtttgattctgatgaatataaatctggattc	Protospacer
. *** *********.*********   * .

76. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

77. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

78. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_AP017613 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_3, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

79. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NC_022996 (Escherichia coli plasmid pO26-CRL-125, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

80. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NC_022992 (Escherichia coli plasmid pO111-CRL-115, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

81. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

82. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

83. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP037942 (Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

84. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027381 (Escherichia coli strain 2013C-3250 plasmid unnamed1) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

85. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027334 (Escherichia coli strain 2013C-3277 plasmid unnamed3) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

86. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to MN334219 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm32 plasmid pSTM32_108, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

87. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to MN334220 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

88. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_AP018803 (Escherichia coli strain E2863 plasmid pE2863-1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

89. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP040264 (Escherichia coli strain 631 plasmid pEc631_1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

90. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027600 (Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

91. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

92. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_LT985320 (Escherichia coli strain ECOR 3 genome assembly, plasmid: RCS85_pII) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

93. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027585 (Escherichia coli strain 00-3076 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

94. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NC_025138 (Escherichia coli plasmid pH2332-107, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

95. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP013024 (Escherichia coli strain 2009C-3133 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

96. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027370 (Escherichia coli strain 2014C-3307 plasmid unnamed2) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

97. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027453 (Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

98. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027453 (Escherichia coli strain 2014C-3338 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

99. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

100. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

101. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP028120 (Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

102. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

103. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_CP023542 (Escherichia coli O104:H21 str. CFSAN002236 strain ATCC BAA-178 plasmid pO104_H21, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

104. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_AP019762 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

105. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to MN335638 (Escherichia coli strain SFE199 plasmid pSFE199, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

106. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to MN335639 (Escherichia coli strain SFE059 plasmid pSFE059, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

107. spacer 1.2|16521|32|NZ_CP014024|PILER-CR,CRT matches to NZ_AP018797 (Escherichia coli strain E2855 plasmid pE2855-1, complete sequence) position: , mismatch: 11, identity: 0.656 

accaattaataacatcctgtttatcaaagtca	CRISPR spacer
tgggggtaataatatcctgtttattaaagggc	Protospacer
   .. ******.***********.****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 18723 19 uncultured_Caudovirales_phage(60.0%) NA NA
DBSCAN-SWA_2 57391 : 59845 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_3 66378 : 74043 4 Ostreococcus_lucimarinus_virus(33.33%) NA NA
DBSCAN-SWA_4 80277 : 81390 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_5 91729 : 92827 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_6 100282 : 105462 4 Apis_mellifera_filamentous_virus(33.33%) NA NA
DBSCAN-SWA_7 123252 : 127058 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_8 151427 : 151832 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_9 157345 : 157894 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_10 165796 : 167224 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_11 188872 : 190123 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_12 198463 : 201340 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 204816 : 210971 5 Brevibacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_14 219897 : 222889 3 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_15 227658 : 229290 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_16 255150 : 257865 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_17 261510 : 262691 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_18 273815 : 275991 2 Vibrio_phage(50.0%) integrase attL 263390:263408|attR 280636:280654
DBSCAN-SWA_19 281499 : 285874 4 Canid_alphaherpesvirus(33.33%) NA NA
DBSCAN-SWA_20 290085 : 291687 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_21 295120 : 298861 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_22 302001 : 302262 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_23 307011 : 321627 9 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_24 325461 : 335133 11 Faustovirus(14.29%) transposase NA
DBSCAN-SWA_25 348622 : 349048 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_26 362724 : 380526 17 Streptococcus_phage(28.57%) NA NA
DBSCAN-SWA_27 385393 : 385687 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_28 388933 : 389947 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 418970 : 425347 5 Catovirus(33.33%) NA NA
DBSCAN-SWA_30 432272 : 433052 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_31 452127 : 452796 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 459951 : 461082 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_33 467631 : 469149 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_34 485504 : 486086 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_35 516228 : 517668 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_36 521706 : 532290 6 Pseudomonas_phage(40.0%) NA NA
DBSCAN-SWA_37 536711 : 537068 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_38 542486 : 558588 20 Haemophilus_phage(30.77%) plate,holin,tail NA
DBSCAN-SWA_39 575599 : 582898 5 Escherichia_phage(75.0%) NA NA
DBSCAN-SWA_40 587576 : 588938 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_41 599839 : 607038 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_42 611133 : 613569 3 Pterostylis_sanguinea_virus(50.0%) NA NA
DBSCAN-SWA_43 620132 : 623159 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_44 641240 : 642367 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_45 645737 : 646364 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_46 656755 : 657787 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_47 668845 : 676457 9 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_48 683726 : 685097 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_49 688957 : 695127 6 Phage_21(33.33%) NA NA
DBSCAN-SWA_50 698373 : 699525 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_51 716350 : 719962 3 Bacillus_phage(66.67%) tRNA NA
DBSCAN-SWA_52 735914 : 744458 9 Prochlorococcus_phage(40.0%) NA NA
DBSCAN-SWA_53 748369 : 752189 4 Pithovirus(66.67%) NA NA
DBSCAN-SWA_54 772439 : 801450 38 Escherichia_phage(25.0%) tail,integrase,terminase attL 777192:777206|attR 784095:784109
DBSCAN-SWA_55 804521 : 807911 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_56 812459 : 816635 4 Enterobacter_phage(66.67%) holin NA
DBSCAN-SWA_57 839962 : 845295 8 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_58 851031 : 853074 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_59 870740 : 871397 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_60 876400 : 886580 9 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_61 896450 : 898438 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_62 903630 : 905352 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_63 910170 : 913164 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_64 920515 : 927949 5 Bodo_saltans_virus(25.0%) protease NA
DBSCAN-SWA_65 934307 : 934904 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_66 939015 : 940959 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_67 957799 : 958366 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_68 968764 : 969709 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_69 1001099 : 1006040 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_70 1013314 : 1014736 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_71 1018542 : 1024931 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_72 1034782 : 1035895 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 1043633 : 1044518 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_74 1049738 : 1051860 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_75 1056715 : 1057986 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_76 1071171 : 1081535 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_77 1101678 : 1105572 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_78 1109808 : 1113608 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_79 1120789 : 1123082 3 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_80 1129221 : 1139256 9 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_81 1150956 : 1161159 11 Bacillus_virus(40.0%) tRNA NA
DBSCAN-SWA_82 1168152 : 1169883 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_83 1189500 : 1195961 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_84 1199386 : 1204440 5 Tupanvirus(50.0%) tRNA,integrase attL 1198727:1198740|attR 1211301:1211314
DBSCAN-SWA_85 1218312 : 1218588 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_86 1242938 : 1249597 6 Ostreococcus_lucimarinus_virus(25.0%) NA NA
DBSCAN-SWA_87 1257669 : 1258455 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_88 1264156 : 1265736 3 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_89 1270273 : 1271830 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_90 1280867 : 1281782 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_91 1299304 : 1301103 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_92 1304984 : 1306259 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_93 1314425 : 1321248 7 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_94 1328030 : 1333244 5 environmental_halophage(33.33%) NA NA
DBSCAN-SWA_95 1339214 : 1343899 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_96 1351566 : 1353375 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_97 1356480 : 1356969 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_98 1360360 : 1364480 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_99 1367777 : 1375851 9 Agrobacterium_phage(40.0%) tRNA NA
DBSCAN-SWA_100 1382664 : 1383555 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_101 1403554 : 1405130 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_102 1416775 : 1417201 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_103 1425915 : 1426710 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_104 1439644 : 1440010 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_105 1443204 : 1443852 1 Apis_mellifera_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_106 1460056 : 1460563 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_107 1501486 : 1502191 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_108 1510298 : 1517468 5 Catovirus(33.33%) holin NA
DBSCAN-SWA_109 1525448 : 1527269 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_110 1542926 : 1550843 5 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_111 1554618 : 1555599 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_112 1569623 : 1575396 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_113 1604566 : 1605229 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_114 1629933 : 1638671 7 Only_Syngen_Nebraska_virus(25.0%) NA NA
DBSCAN-SWA_115 1646385 : 1649472 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_116 1654233 : 1665610 11 Morganella_phage(40.0%) protease NA
DBSCAN-SWA_117 1675490 : 1675814 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_118 1681020 : 1682034 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_119 1686006 : 1690058 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_120 1711597 : 1713102 3 Morganella_phage(50.0%) integrase attL 1703075:1703089|attR 1713906:1713920
DBSCAN-SWA_121 1719742 : 1740421 27 Morganella_phage(58.33%) integrase attL 1723139:1723180|attR 1735659:1735700
DBSCAN-SWA_122 1753646 : 1846932 91 Salmonella_phage(22.0%) tRNA,lysis,holin,capsid,tail,terminase NA
DBSCAN-SWA_123 1850093 : 1857143 13 Escherichia_phage(42.86%) integrase attL 1852123:1852137|attR 1861329:1861343
DBSCAN-SWA_124 1869808 : 1900898 24 Tetraselmis_virus(15.38%) tRNA,protease NA
DBSCAN-SWA_125 1906769 : 1913125 10 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_126 1921514 : 1925638 4 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_127 1933005 : 1950071 14 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_128 1954718 : 1956746 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_129 1967175 : 1967835 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_130 1980825 : 1997315 15 Morganella_phage(14.29%) tRNA NA
DBSCAN-SWA_131 2003447 : 2004356 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_132 2011241 : 2015871 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_133 2018942 : 2020427 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_134 2023714 : 2025854 2 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_135 2046858 : 2048625 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_136 2057042 : 2065377 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_137 2076302 : 2076533 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_138 2092407 : 2094918 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_139 2100083 : 2101139 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_140 2106376 : 2107090 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_141 2113807 : 2118651 3 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_142 2125762 : 2137558 12 Mycobacterium_phage(22.22%) NA NA
DBSCAN-SWA_143 2148141 : 2149322 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_144 2162768 : 2163800 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_145 2178813 : 2182901 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_146 2191802 : 2192555 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_147 2207162 : 2210358 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_148 2213631 : 2223365 8 environmental_halophage(25.0%) tRNA NA
DBSCAN-SWA_149 2226978 : 2229876 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_150 2235411 : 2239670 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_151 2243056 : 2249456 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_152 2257359 : 2258873 2 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_153 2271663 : 2272575 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_154 2285704 : 2285905 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_155 2303449 : 2307643 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_156 2312636 : 2318613 6 Erwinia_phage(25.0%) NA NA
DBSCAN-SWA_157 2323536 : 2333252 8 Escherichia_phage(20.0%) tRNA NA
DBSCAN-SWA_158 2363896 : 2364256 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_159 2373855 : 2374815 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_160 2390519 : 2398863 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_161 2406880 : 2407372 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_162 2411964 : 2414611 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_163 2418778 : 2427028 10 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_164 2445645 : 2446689 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_165 2471649 : 2473118 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_166 2477902 : 2480623 3 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_167 2484012 : 2489610 5 Dickeya_phage(40.0%) transposase NA
DBSCAN-SWA_168 2498288 : 2502986 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_169 2507008 : 2508169 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_170 2516500 : 2518489 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_171 2522818 : 2523958 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_172 2547047 : 2547605 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_173 2550619 : 2551729 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_174 2559901 : 2560204 1 Caulobacter_virus(100.0%) NA NA
DBSCAN-SWA_175 2565117 : 2576691 9 Escherichia_phage(57.14%) NA NA
DBSCAN-SWA_176 2583612 : 2586302 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_177 2589869 : 2590226 1 Dinoroseobacter_phage(100.0%) NA NA
DBSCAN-SWA_178 2621040 : 2628067 4 Leptospira_phage(33.33%) integrase,transposase attL 2623889:2623905|attR 2640005:2640021
DBSCAN-SWA_179 2633672 : 2648261 10 Leptospira_phage(33.33%) tRNA NA
DBSCAN-SWA_180 2658439 : 2659375 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_181 2672501 : 2681078 10 Vibrio_phage(20.0%) NA NA
DBSCAN-SWA_182 2686164 : 2691036 4 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_183 2696455 : 2699188 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_184 2703657 : 2706552 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_185 2712339 : 2714984 4 Indivirus(25.0%) NA NA
DBSCAN-SWA_186 2719344 : 2721537 3 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_187 2743069 : 2749032 4 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_188 2754307 : 2757570 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_189 2760799 : 2761342 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_190 2771211 : 2773038 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_191 2784075 : 2787942 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_192 2805664 : 2811844 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_193 2816783 : 2822099 4 Streptomyces_phage(33.33%) NA NA
DBSCAN-SWA_194 2829604 : 2831251 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_195 2843870 : 2847720 5 Pandoravirus(25.0%) tRNA NA
DBSCAN-SWA_196 2866739 : 2870839 3 Mollivirus(33.33%) NA NA
DBSCAN-SWA_197 2879855 : 2881745 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_198 2916337 : 2922122 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_199 2926863 : 2931709 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_200 2937943 : 2939128 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_201 2954755 : 2961365 5 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_202 2970257 : 2972189 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_203 2976002 : 2977031 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_204 2981746 : 2990483 8 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_205 2993686 : 2994984 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_206 3006873 : 3008521 2 Methanothermobacter_phage(50.0%) NA NA
DBSCAN-SWA_207 3016299 : 3017118 1 Grouper_iridovirus(100.0%) NA NA
DBSCAN-SWA_208 3020223 : 3022449 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_209 3033903 : 3040165 5 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_210 3050282 : 3051356 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_211 3054573 : 3062051 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_212 3096732 : 3097749 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_213 3101765 : 3105137 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_214 3121498 : 3123013 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_215 3137882 : 3148324 7 Organic_Lake_phycodnavirus(40.0%) NA NA
DBSCAN-SWA_216 3153250 : 3157508 5 Trichoplusia_ni_ascovirus(50.0%) tRNA NA
DBSCAN-SWA_217 3160967 : 3162005 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_218 3171368 : 3172988 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_219 3184464 : 3185460 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_220 3190957 : 3196983 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_221 3208898 : 3210587 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_222 3247742 : 3249788 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_223 3252899 : 3255391 2 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_224 3260837 : 3333554 60 Cronobacter_phage(14.29%) plate,protease NA
DBSCAN-SWA_225 3343980 : 3356675 12 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_226 3360353 : 3363749 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_227 3378804 : 3380187 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_228 3385155 : 3390374 4 Orpheovirus(33.33%) NA NA
DBSCAN-SWA_229 3407315 : 3413100 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_230 3423359 : 3426152 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_231 3430652 : 3431225 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_232 3440032 : 3440608 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_233 3460955 : 3462893 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_234 3468689 : 3487145 15 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_235 3496499 : 3497516 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_236 3504934 : 3509011 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_237 3525969 : 3532789 4 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_238 3543844 : 3544468 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_239 3562202 : 3562970 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_240 3570862 : 3572281 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_241 3584355 : 3591094 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_242 3614433 : 3615573 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_243 3620139 : 3624108 4 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_244 3638998 : 3641632 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_245 3645793 : 3658126 8 uncultured_Mediterranean_phage(20.0%) NA NA
DBSCAN-SWA_246 3664513 : 3665860 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_247 3672764 : 3677151 5 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_248 3682268 : 3688468 7 Alteromonas_phage(33.33%) NA NA
DBSCAN-SWA_249 3697538 : 3698153 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_250 3709590 : 3710247 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_251 3717586 : 3719128 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_252 3729694 : 3729982 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_253 3761673 : 3763263 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_254 3768972 : 3777696 6 Geobacillus_virus(33.33%) NA NA
DBSCAN-SWA_255 3786614 : 3793750 4 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_256 3807196 : 3833258 25 Caulobacter_phage(18.18%) tRNA,protease NA
DBSCAN-SWA_257 3842907 : 3844071 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_258 3856652 : 3857558 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_259 3861766 : 3862042 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_260 3870173 : 3876038 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_261 3887232 : 3893962 7 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_262 3916190 : 3921344 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_263 3924579 : 3929556 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_264 3938100 : 3939387 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_265 3961626 : 3962091 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_266 3976238 : 3977129 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_267 3993404 : 3994631 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_268 3999848 : 4002590 2 Vibrio_phage(50.0%) holin NA
DBSCAN-SWA_269 4008257 : 4010485 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_270 4037504 : 4038764 1 Bovine_gammaherpesvirus(100.0%) NA NA
DBSCAN-SWA_271 4043775 : 4044354 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_272 4053696 : 4054608 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_273 4063050 : 4065410 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_274 4069514 : 4074687 4 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_275 4084750 : 4088840 3 Escherichia_coli_O157_typing_phage(50.0%) NA NA
DBSCAN-SWA_276 4093813 : 4096387 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_277 4108239 : 4108911 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_278 4115319 : 4115967 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_279 4123877 : 4125320 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_280 4128938 : 4136109 6 uncultured_Mediterranean_phage(40.0%) tRNA NA
DBSCAN-SWA_281 4153220 : 4154426 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_282 4164657 : 4165395 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_283 4188377 : 4189985 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_284 4206123 : 4210584 4 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_285 4229267 : 4235793 5 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_286 4241001 : 4241346 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_287 4244954 : 4246286 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 4249507 : 4253381 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_289 4267855 : 4273568 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_290 4287825 : 4290771 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_291 4295090 : 4295777 1 Planktothrix_phage(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage