Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014326 Streptococcus mitis strain SVGS_061 chromosome, complete genome 5 crisprs DEDDh,cas3,DinG 9 42 11 0

Results visualization

1. NZ_CP014326
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014326_1 1089783-1089862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014326_2 1558602-1558698 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014326_3 1737070-1745691 Orphan NA
99 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014326_4 1928965-1929051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014326_5 2049264-2049359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014326_3 3.41|1742764|30|NZ_CP014326|CRT 1742764-1742793 30 NZ_CP014326.1 1737040-1737069 1 0.967
NZ_CP014326_3 3.44|1742908|30|NZ_CP014326|CRT 1742908-1742937 30 NZ_CP014326.1 1737040-1737069 1 0.967
NZ_CP014326_3 3.65|1743964|30|NZ_CP014326|CRT 1743964-1743993 30 NZ_CP014326.1 1737040-1737069 1 0.967
NZ_CP014326_3 3.84|1744924|30|NZ_CP014326|CRT 1744924-1744953 30 NZ_CP014326.1 1736944-1736973 1 0.967
NZ_CP014326_3 3.84|1744924|30|NZ_CP014326|CRT 1744924-1744953 30 NZ_CP014326.1 1736992-1737021 1 0.967
NZ_CP014326_3 3.86|1745020|18|NZ_CP014326|CRT 1745020-1745037 18 NZ_CP014326.1 1745980-1745997 1 0.944
NZ_CP014326_3 3.86|1745020|18|NZ_CP014326|CRT 1745020-1745037 18 NZ_CP014326.1 1746028-1746045 1 0.944
NZ_CP014326_3 3.55|1743460|30|NZ_CP014326|CRT 1743460-1743489 30 NZ_CP014326.1 1737040-1737069 2 0.933
NZ_CP014326_3 3.57|1743556|30|NZ_CP014326|CRT 1743556-1743585 30 NZ_CP014326.1 1737040-1737069 2 0.933
NZ_CP014326_3 3.79|1744660|30|NZ_CP014326|CRT 1744660-1744689 30 NZ_CP014326.1 1737040-1737069 2 0.933
NZ_CP014326_3 3.84|1744924|30|NZ_CP014326|CRT 1744924-1744953 30 NZ_CP014326.1 1737064-1737093 2 0.933
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP014326.1 1737016-1737045 2 0.933
NZ_CP014326_3 3.86|1745020|18|NZ_CP014326|CRT 1745020-1745037 18 NZ_CP014326.1 1745788-1745805 2 0.889
NZ_CP014326_3 3.86|1745020|18|NZ_CP014326|CRT 1745020-1745037 18 NZ_CP014326.1 1745884-1745901 2 0.889

1. spacer 3.41|1742764|30|NZ_CP014326|CRT matches to position: 1737040-1737069, mismatch: 1, identity: 0.967

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
agctgatgtacttgctgattggctcgcact	Protospacer
*********.********************

2. spacer 3.44|1742908|30|NZ_CP014326|CRT matches to position: 1737040-1737069, mismatch: 1, identity: 0.967

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
agctgatgtacttgctgattggctcgcact	Protospacer
*********.********************

3. spacer 3.65|1743964|30|NZ_CP014326|CRT matches to position: 1737040-1737069, mismatch: 1, identity: 0.967

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
agctgatgtacttgctgattggctcgcact	Protospacer
*********.********************

4. spacer 3.84|1744924|30|NZ_CP014326|CRT matches to position: 1736944-1736973, mismatch: 1, identity: 0.967

cgcacttgttgatgctgactcagaggcact	CRISPR spacer
cgcacttgttgatgctgactcagaggcgct	Protospacer
***************************.**

5. spacer 3.84|1744924|30|NZ_CP014326|CRT matches to position: 1736992-1737021, mismatch: 1, identity: 0.967

cgcacttgttgatgctgactcagaggcact	CRISPR spacer
cgcacttgttgatgctgactcagatgcact	Protospacer
************************ *****

6. spacer 3.86|1745020|18|NZ_CP014326|CRT matches to position: 1745980-1745997, mismatch: 1, identity: 0.944

cgcacttgttgatgcact	CRISPR spacer
cgcgcttgttgatgcact	Protospacer
***.**************

7. spacer 3.86|1745020|18|NZ_CP014326|CRT matches to position: 1746028-1746045, mismatch: 1, identity: 0.944

cgcacttgttgatgcact	CRISPR spacer
cgcgcttgttgatgcact	Protospacer
***.**************

8. spacer 3.55|1743460|30|NZ_CP014326|CRT matches to position: 1737040-1737069, mismatch: 2, identity: 0.933

agctgatgtgcttgctgattggcttgcact	CRISPR spacer
agctgatgtacttgctgattggctcgcact	Protospacer
*********.**************.*****

9. spacer 3.57|1743556|30|NZ_CP014326|CRT matches to position: 1737040-1737069, mismatch: 2, identity: 0.933

agccgatgtgcttgctgattggctcgcact	CRISPR spacer
agctgatgtacttgctgattggctcgcact	Protospacer
***.*****.********************

10. spacer 3.79|1744660|30|NZ_CP014326|CRT matches to position: 1737040-1737069, mismatch: 2, identity: 0.933

agctgatgtgcttgctgattggcttgcact	CRISPR spacer
agctgatgtacttgctgattggctcgcact	Protospacer
*********.**************.*****

11. spacer 3.84|1744924|30|NZ_CP014326|CRT matches to position: 1737064-1737093, mismatch: 2, identity: 0.933

cgcacttgttgatgctgactcagaggcact	CRISPR spacer
cgcacttgttgatgctgactcagaagcgct	Protospacer
************************.**.**

12. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to position: 1737016-1737045, mismatch: 2, identity: 0.933

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgccgattcagaagctga	Protospacer
***************.***********.**

13. spacer 3.86|1745020|18|NZ_CP014326|CRT matches to position: 1745788-1745805, mismatch: 2, identity: 0.889

cgcacttgttgatgcact	CRISPR spacer
cgcgcttgttgaggcact	Protospacer
***.******** *****

14. spacer 3.86|1745020|18|NZ_CP014326|CRT matches to position: 1745884-1745901, mismatch: 2, identity: 0.889

cgcacttgttgatgcact	CRISPR spacer
cgcgcttgttgaggcact	Protospacer
***.******** *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NZ_LT571450 Staphylococcus epidermidis isolate BPH0662 plasmid 2 6527-6556 3 0.9
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NZ_LT571450 Staphylococcus epidermidis isolate BPH0662 plasmid 2 6551-6580 3 0.9
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40158-40187 3 0.9
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40278-40307 3 0.9
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40914-40943 3 0.9
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40698-40727 4 0.867
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 41478-41507 4 0.867
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48186-48215 4 0.867
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 24611-24640 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25199-25228 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25745-25774 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26951-26980 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27455-27484 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27917-27946 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28211-28240 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28793-28822 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29537-29566 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 30041-30070 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 24611-24640 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25199-25228 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25745-25774 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26951-26980 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27455-27484 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27917-27946 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28211-28240 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28793-28822 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29537-29566 5 0.833
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 30041-30070 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 24611-24640 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25199-25228 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25745-25774 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26951-26980 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27455-27484 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27917-27946 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28211-28240 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28793-28822 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29537-29566 5 0.833
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 30041-30070 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 24611-24640 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25199-25228 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25745-25774 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26951-26980 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27455-27484 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27917-27946 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28211-28240 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28793-28822 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29537-29566 5 0.833
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 30041-30070 5 0.833
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 6 0.8
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 6 0.8
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 6 0.8
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 6 0.8
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 6 0.8
NZ_CP014326_3 3.45|1742956|30|NZ_CP014326|CRT 1742956-1742985 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 6 0.8
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 6 0.8
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 6 0.8
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 6 0.8
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 6 0.8
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 6 0.8
NZ_CP014326_3 3.66|1744012|30|NZ_CP014326|CRT 1744012-1744041 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 6 0.8
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 6 0.8
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 6 0.8
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 6 0.8
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 6 0.8
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 6 0.8
NZ_CP014326_3 3.68|1744108|30|NZ_CP014326|CRT 1744108-1744137 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 6 0.8
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 6 0.8
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 6 0.8
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 6 0.8
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 6 0.8
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 6 0.8
NZ_CP014326_3 3.69|1744156|30|NZ_CP014326|CRT 1744156-1744185 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 6 0.8
NZ_CP014326_3 3.84|1744924|30|NZ_CP014326|CRT 1744924-1744953 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 455992-456021 6 0.8
NZ_CP014326_3 3.38|1742620|30|NZ_CP014326|CRT 1742620-1742649 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 7 0.767
NZ_CP014326_3 3.38|1742620|30|NZ_CP014326|CRT 1742620-1742649 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 7 0.767
NZ_CP014326_3 3.38|1742620|30|NZ_CP014326|CRT 1742620-1742649 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 7 0.767
NZ_CP014326_3 3.38|1742620|30|NZ_CP014326|CRT 1742620-1742649 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 7 0.767
NZ_CP014326_3 3.38|1742620|30|NZ_CP014326|CRT 1742620-1742649 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 7 0.767
NZ_CP014326_3 3.38|1742620|30|NZ_CP014326|CRT 1742620-1742649 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 7 0.767
NZ_CP014326_3 3.41|1742764|30|NZ_CP014326|CRT 1742764-1742793 30 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 159761-159790 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 24611-24640 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25199-25228 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 25745-25774 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26951-26980 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27455-27484 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27917-27946 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28211-28240 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28793-28822 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29537-29566 7 0.767
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 30041-30070 7 0.767
NZ_CP014326_3 3.44|1742908|30|NZ_CP014326|CRT 1742908-1742937 30 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 159761-159790 7 0.767
NZ_CP014326_3 3.50|1743220|30|NZ_CP014326|CRT 1743220-1743249 30 MF754113 Vibrio phage vB_VpaS_KF3, complete genome 71191-71220 7 0.767
NZ_CP014326_3 3.50|1743220|30|NZ_CP014326|CRT 1743220-1743249 30 MF754114 Vibrio phage vB_VpaS_KF4, complete genome 16595-16624 7 0.767
NZ_CP014326_3 3.52|1743316|30|NZ_CP014326|CRT 1743316-1743345 30 MF754113 Vibrio phage vB_VpaS_KF3, complete genome 71191-71220 7 0.767
NZ_CP014326_3 3.52|1743316|30|NZ_CP014326|CRT 1743316-1743345 30 MF754114 Vibrio phage vB_VpaS_KF4, complete genome 16595-16624 7 0.767
NZ_CP014326_3 3.56|1743508|30|NZ_CP014326|CRT 1743508-1743537 30 MF754113 Vibrio phage vB_VpaS_KF3, complete genome 71191-71220 7 0.767
NZ_CP014326_3 3.56|1743508|30|NZ_CP014326|CRT 1743508-1743537 30 MF754114 Vibrio phage vB_VpaS_KF4, complete genome 16595-16624 7 0.767
NZ_CP014326_3 3.61|1743772|30|NZ_CP014326|CRT 1743772-1743801 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 7 0.767
NZ_CP014326_3 3.61|1743772|30|NZ_CP014326|CRT 1743772-1743801 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 7 0.767
NZ_CP014326_3 3.61|1743772|30|NZ_CP014326|CRT 1743772-1743801 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 7 0.767
NZ_CP014326_3 3.61|1743772|30|NZ_CP014326|CRT 1743772-1743801 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 7 0.767
NZ_CP014326_3 3.61|1743772|30|NZ_CP014326|CRT 1743772-1743801 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 7 0.767
NZ_CP014326_3 3.61|1743772|30|NZ_CP014326|CRT 1743772-1743801 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 7 0.767
NZ_CP014326_3 3.65|1743964|30|NZ_CP014326|CRT 1743964-1743993 30 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 159761-159790 7 0.767
NZ_CP014326_3 3.74|1744420|30|NZ_CP014326|CRT 1744420-1744449 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26669-26698 7 0.767
NZ_CP014326_3 3.74|1744420|30|NZ_CP014326|CRT 1744420-1744449 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26747-26776 7 0.767
NZ_CP014326_3 3.74|1744420|30|NZ_CP014326|CRT 1744420-1744449 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27749-27778 7 0.767
NZ_CP014326_3 3.74|1744420|30|NZ_CP014326|CRT 1744420-1744449 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28589-28618 7 0.767
NZ_CP014326_3 3.74|1744420|30|NZ_CP014326|CRT 1744420-1744449 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29255-29284 7 0.767
NZ_CP014326_3 3.74|1744420|30|NZ_CP014326|CRT 1744420-1744449 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29333-29362 7 0.767
NZ_CP014326_3 3.76|1744516|30|NZ_CP014326|CRT 1744516-1744545 30 MF754113 Vibrio phage vB_VpaS_KF3, complete genome 71191-71220 7 0.767
NZ_CP014326_3 3.76|1744516|30|NZ_CP014326|CRT 1744516-1744545 30 MF754114 Vibrio phage vB_VpaS_KF4, complete genome 16595-16624 7 0.767
NZ_CP014326_3 3.80|1744708|30|NZ_CP014326|CRT 1744708-1744737 30 MF754113 Vibrio phage vB_VpaS_KF3, complete genome 71191-71220 7 0.767
NZ_CP014326_3 3.80|1744708|30|NZ_CP014326|CRT 1744708-1744737 30 MF754114 Vibrio phage vB_VpaS_KF4, complete genome 16595-16624 7 0.767
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48504-48533 7 0.767
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NZ_CP031076 Bacillus mycoides strain BPN401 plasmid pl36, complete sequence 12385-12414 7 0.767
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 637290-637319 7 0.767
NZ_CP014326_3 3.83|1744876|30|NZ_CP014326|CRT 1744876-1744905 30 NZ_AF135182 Serratia entomophila strain A1MO2 plasmid pADAP, complete sequence 134352-134381 7 0.767
NZ_CP014326_3 3.83|1744876|30|NZ_CP014326|CRT 1744876-1744905 30 NC_002523 Serratia entomophila plasmid pADAP, complete sequence 133914-133943 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 47412-47441 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48282-48311 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48528-48557 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 49668-49697 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 319-348 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 937-966 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40182-40211 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40722-40751 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40938-40967 7 0.767
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 41502-41531 7 0.767
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48504-48533 7 0.767
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NZ_CP031076 Bacillus mycoides strain BPN401 plasmid pl36, complete sequence 12385-12414 7 0.767
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 MN693524 Marine virus AFVG_25M219, complete genome 9734-9763 7 0.767
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 MN693341 Marine virus AFVG_25M304, complete genome 27922-27951 7 0.767
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 MN693607 Marine virus AFVG_25M305, complete genome 28307-28336 7 0.767
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 KU236381 Enterobacteria phage DT530 tail fiber protein AB gene, complete cds 1935-1964 7 0.767
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 NC_047749 Enterobacteria phage DT571/2, complete genome 73841-73870 7 0.767
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 KM979354 Enterobacteria phage DT57C, complete genome 73485-73514 7 0.767
NZ_CP014326_3 3.93|1745356|30|NZ_CP014326|CRT 1745356-1745385 30 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 675118-675147 7 0.767
NZ_CP014326_3 3.94|1745404|30|NZ_CP014326|CRT 1745404-1745433 30 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 675118-675147 7 0.767
NZ_CP014326_3 3.98|1745596|30|NZ_CP014326|CRT 1745596-1745625 30 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1487950-1487979 7 0.767
NZ_CP014326_3 3.39|1742668|30|NZ_CP014326|CRT 1742668-1742697 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 8 0.733
NZ_CP014326_3 3.39|1742668|30|NZ_CP014326|CRT 1742668-1742697 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 8 0.733
NZ_CP014326_3 3.39|1742668|30|NZ_CP014326|CRT 1742668-1742697 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 8 0.733
NZ_CP014326_3 3.39|1742668|30|NZ_CP014326|CRT 1742668-1742697 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 8 0.733
NZ_CP014326_3 3.39|1742668|30|NZ_CP014326|CRT 1742668-1742697 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 8 0.733
NZ_CP014326_3 3.39|1742668|30|NZ_CP014326|CRT 1742668-1742697 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 8 0.733
NZ_CP014326_3 3.40|1742716|30|NZ_CP014326|CRT 1742716-1742745 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 8 0.733
NZ_CP014326_3 3.40|1742716|30|NZ_CP014326|CRT 1742716-1742745 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 8 0.733
NZ_CP014326_3 3.40|1742716|30|NZ_CP014326|CRT 1742716-1742745 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 8 0.733
NZ_CP014326_3 3.40|1742716|30|NZ_CP014326|CRT 1742716-1742745 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 8 0.733
NZ_CP014326_3 3.40|1742716|30|NZ_CP014326|CRT 1742716-1742745 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 8 0.733
NZ_CP014326_3 3.40|1742716|30|NZ_CP014326|CRT 1742716-1742745 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 8 0.733
NZ_CP014326_3 3.41|1742764|30|NZ_CP014326|CRT 1742764-1742793 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.43|1742860|30|NZ_CP014326|CRT 1742860-1742889 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 8 0.733
NZ_CP014326_3 3.43|1742860|30|NZ_CP014326|CRT 1742860-1742889 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 8 0.733
NZ_CP014326_3 3.43|1742860|30|NZ_CP014326|CRT 1742860-1742889 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 8 0.733
NZ_CP014326_3 3.43|1742860|30|NZ_CP014326|CRT 1742860-1742889 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 8 0.733
NZ_CP014326_3 3.43|1742860|30|NZ_CP014326|CRT 1742860-1742889 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 8 0.733
NZ_CP014326_3 3.43|1742860|30|NZ_CP014326|CRT 1742860-1742889 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 8 0.733
NZ_CP014326_3 3.44|1742908|30|NZ_CP014326|CRT 1742908-1742937 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.48|1743124|30|NZ_CP014326|CRT 1743124-1743153 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.55|1743460|30|NZ_CP014326|CRT 1743460-1743489 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.57|1743556|30|NZ_CP014326|CRT 1743556-1743585 30 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 522056-522085 8 0.733
NZ_CP014326_3 3.57|1743556|30|NZ_CP014326|CRT 1743556-1743585 30 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 159761-159790 8 0.733
NZ_CP014326_3 3.57|1743556|30|NZ_CP014326|CRT 1743556-1743585 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.58|1743604|30|NZ_CP014326|CRT 1743604-1743633 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.62|1743820|30|NZ_CP014326|CRT 1743820-1743849 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 8 0.733
NZ_CP014326_3 3.62|1743820|30|NZ_CP014326|CRT 1743820-1743849 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 8 0.733
NZ_CP014326_3 3.62|1743820|30|NZ_CP014326|CRT 1743820-1743849 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 8 0.733
NZ_CP014326_3 3.62|1743820|30|NZ_CP014326|CRT 1743820-1743849 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 8 0.733
NZ_CP014326_3 3.62|1743820|30|NZ_CP014326|CRT 1743820-1743849 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 8 0.733
NZ_CP014326_3 3.62|1743820|30|NZ_CP014326|CRT 1743820-1743849 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 8 0.733
NZ_CP014326_3 3.63|1743868|30|NZ_CP014326|CRT 1743868-1743897 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 8 0.733
NZ_CP014326_3 3.63|1743868|30|NZ_CP014326|CRT 1743868-1743897 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 8 0.733
NZ_CP014326_3 3.63|1743868|30|NZ_CP014326|CRT 1743868-1743897 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 8 0.733
NZ_CP014326_3 3.63|1743868|30|NZ_CP014326|CRT 1743868-1743897 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 8 0.733
NZ_CP014326_3 3.63|1743868|30|NZ_CP014326|CRT 1743868-1743897 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 8 0.733
NZ_CP014326_3 3.63|1743868|30|NZ_CP014326|CRT 1743868-1743897 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 8 0.733
NZ_CP014326_3 3.64|1743916|30|NZ_CP014326|CRT 1743916-1743945 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 8 0.733
NZ_CP014326_3 3.64|1743916|30|NZ_CP014326|CRT 1743916-1743945 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 8 0.733
NZ_CP014326_3 3.64|1743916|30|NZ_CP014326|CRT 1743916-1743945 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 8 0.733
NZ_CP014326_3 3.64|1743916|30|NZ_CP014326|CRT 1743916-1743945 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 8 0.733
NZ_CP014326_3 3.64|1743916|30|NZ_CP014326|CRT 1743916-1743945 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 8 0.733
NZ_CP014326_3 3.64|1743916|30|NZ_CP014326|CRT 1743916-1743945 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 8 0.733
NZ_CP014326_3 3.65|1743964|30|NZ_CP014326|CRT 1743964-1743993 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.72|1744324|30|NZ_CP014326|CRT 1744324-1744353 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.79|1744660|30|NZ_CP014326|CRT 1744660-1744689 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 31154-31183 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 47412-47441 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48282-48311 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48528-48557 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 49668-49697 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 319-348 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 937-966 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40182-40211 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40722-40751 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40938-40967 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 41502-41531 8 0.733
NZ_CP014326_3 3.82|1744828|30|NZ_CP014326|CRT 1744828-1744857 30 MH616889 Microviridae sp. isolate ctdc79, complete genome 2160-2189 8 0.733
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_LT571450 Staphylococcus epidermidis isolate BPH0662 plasmid 2 6503-6532 8 0.733
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_LT571450 Staphylococcus epidermidis isolate BPH0662 plasmid 2 6815-6844 8 0.733
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_LT571450 Staphylococcus epidermidis isolate BPH0662 plasmid 2 7475-7504 8 0.733
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40476-40505 8 0.733
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 41256-41285 8 0.733
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP031076 Bacillus mycoides strain BPN401 plasmid pl36, complete sequence 12385-12414 8 0.733
NZ_CP014326_3 3.89|1745164|30|NZ_CP014326|CRT 1745164-1745193 30 MN856028 Myoviridae sp. isolate 287, complete genome 9059-9088 8 0.733
NZ_CP014326_3 3.90|1745212|30|NZ_CP014326|CRT 1745212-1745241 30 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 675118-675147 8 0.733
NZ_CP014326_3 3.90|1745212|30|NZ_CP014326|CRT 1745212-1745241 30 MN693476 Marine virus AFVG_25M323, complete genome 28663-28692 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 47412-47441 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48282-48311 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 48528-48557 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NZ_CP023967 Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence 49668-49697 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 319-348 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 937-966 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40182-40211 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40722-40751 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 40938-40967 8 0.733
NZ_CP014326_3 3.91|1745260|30|NZ_CP014326|CRT 1745260-1745289 30 NC_013381 Staphylococcus epidermidis plasmid SAP107A, complete sequence 41502-41531 8 0.733
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 NZ_CP032703 Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence 505971-506000 8 0.733
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 MN693072 Marine virus AFVG_25M5, complete genome 10972-11001 8 0.733
NZ_CP014326_3 3.92|1745308|30|NZ_CP014326|CRT 1745308-1745337 30 MN693219 Marine virus AFVG_25M370, complete genome 26914-26943 8 0.733
NZ_CP014326_3 3.95|1745452|30|NZ_CP014326|CRT 1745452-1745481 30 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 675118-675147 8 0.733
NZ_CP014326_3 3.96|1745500|30|NZ_CP014326|CRT 1745500-1745529 30 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 675118-675147 8 0.733
NZ_CP014326_3 3.96|1745500|30|NZ_CP014326|CRT 1745500-1745529 30 MN693476 Marine virus AFVG_25M323, complete genome 28663-28692 8 0.733
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 26909-26938 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27539-27568 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27833-27862 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 27875-27904 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28169-28198 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 28751-28780 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 29495-29524 9 0.7
NZ_CP014326_3 3.42|1742812|30|NZ_CP014326|CRT 1742812-1742841 30 NZ_CP046029 Staphylococcus chromogenes strain 1401 plasmid unnamed1 30125-30154 9 0.7
NZ_CP014326_3 3.85|1744972|30|NZ_CP014326|CRT 1744972-1745001 30 NZ_CP032703 Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence 505971-506000 9 0.7
NZ_CP014326_3 3.99|1745644|30|NZ_CP014326|CRT 1745644-1745673 30 MN693341 Marine virus AFVG_25M304, complete genome 27922-27951 9 0.7
NZ_CP014326_3 3.99|1745644|30|NZ_CP014326|CRT 1745644-1745673 30 MN693219 Marine virus AFVG_25M370, complete genome 26914-26943 9 0.7
NZ_CP014326_3 3.99|1745644|30|NZ_CP014326|CRT 1745644-1745673 30 MN693607 Marine virus AFVG_25M305, complete genome 28307-28336 9 0.7
NZ_CP014326_3 3.99|1745644|30|NZ_CP014326|CRT 1745644-1745673 30 MN693072 Marine virus AFVG_25M5, complete genome 10972-11001 9 0.7
NZ_CP014326_3 3.99|1745644|30|NZ_CP014326|CRT 1745644-1745673 30 MN693524 Marine virus AFVG_25M219, complete genome 9734-9763 9 0.7

1. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NZ_LT571450 (Staphylococcus epidermidis isolate BPH0662 plasmid 2) position: , mismatch: 3, identity: 0.9

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgcacttgttgacgctgagtcagatgcact	Protospacer
.***************** ***** *****

2. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NZ_LT571450 (Staphylococcus epidermidis isolate BPH0662 plasmid 2) position: , mismatch: 3, identity: 0.9

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgcacttgttgacgctgaatcagatgcact	Protospacer
.***************** ***** *****

3. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 3, identity: 0.9

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgcacttgttgacgctgagtcagatgcact	Protospacer
.***************** ***** *****

4. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 3, identity: 0.9

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgcacttgttgacgctgagtcagatgcact	Protospacer
.***************** ***** *****

5. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 3, identity: 0.9

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgcacttgttgacgctgagtcagatgcact	Protospacer
.***************** ***** *****

6. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 4, identity: 0.867

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgtacttgttgacgctgagtcagatgcact	Protospacer
.*.*************** ***** *****

7. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 4, identity: 0.867

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgtacttgttgacgctgagtcagatgcact	Protospacer
.*.*************** ***** *****

8. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
tgtacttgttgacgctgagtcagatgcact	Protospacer
.*.*************** ***** *****

9. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

10. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

11. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

12. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

13. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

14. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

15. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

16. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

17. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

18. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

19. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

20. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

21. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

22. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

23. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

24. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

25. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

26. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

27. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

28. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

29. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

30. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

31. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

32. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

33. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

34. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

35. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

36. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

37. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

38. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

39. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

40. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

41. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

42. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

43. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

44. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

45. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

46. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

47. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

48. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

agctgatgtacttgctgattctgacgcact	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . *********************  ****

49. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

50. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

51. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

52. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

53. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

54. spacer 3.45|1742956|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

55. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

56. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

57. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

58. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

59. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

60. spacer 3.66|1744012|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

61. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

62. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

63. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

64. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

65. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

66. spacer 3.68|1744108|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

67. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

68. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

69. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

70. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

71. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

72. spacer 3.69|1744156|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

agctgatgtacttgctgattctgacgcact	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . .********************  ****

73. spacer 3.84|1744924|30|NZ_CP014326|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.8

cgcacttgttgatgctgactcagaggcact	CRISPR spacer
tgcaattgttgatgctgactcaaagatacc	Protospacer
.*** *****************.**..**.

74. spacer 3.38|1742620|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

75. spacer 3.38|1742620|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

76. spacer 3.38|1742620|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

77. spacer 3.38|1742620|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

78. spacer 3.38|1742620|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

79. spacer 3.38|1742620|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

80. spacer 3.41|1742764|30|NZ_CP014326|CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 7, identity: 0.767

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
cattgacgtgcttgccgattggctcgccca	Protospacer
 ..***.********.*********** * 

81. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

82. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

83. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

84. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

85. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

86. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

87. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

88. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

89. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

90. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtacttgctgattctgagtcact	Protospacer
 . ***************.*****  *.**

91. spacer 3.44|1742908|30|NZ_CP014326|CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 7, identity: 0.767

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
cattgacgtgcttgccgattggctcgccca	Protospacer
 ..***.********.*********** * 

92. spacer 3.50|1743220|30|NZ_CP014326|CRT matches to MF754113 (Vibrio phage vB_VpaS_KF3, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

93. spacer 3.50|1743220|30|NZ_CP014326|CRT matches to MF754114 (Vibrio phage vB_VpaS_KF4, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

94. spacer 3.52|1743316|30|NZ_CP014326|CRT matches to MF754113 (Vibrio phage vB_VpaS_KF3, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

95. spacer 3.52|1743316|30|NZ_CP014326|CRT matches to MF754114 (Vibrio phage vB_VpaS_KF4, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

96. spacer 3.56|1743508|30|NZ_CP014326|CRT matches to MF754113 (Vibrio phage vB_VpaS_KF3, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

97. spacer 3.56|1743508|30|NZ_CP014326|CRT matches to MF754114 (Vibrio phage vB_VpaS_KF4, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

98. spacer 3.61|1743772|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

99. spacer 3.61|1743772|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

100. spacer 3.61|1743772|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

101. spacer 3.61|1743772|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

102. spacer 3.61|1743772|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

103. spacer 3.61|1743772|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

104. spacer 3.65|1743964|30|NZ_CP014326|CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 7, identity: 0.767

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
cattgacgtgcttgccgattggctcgccca	Protospacer
 ..***.********.*********** * 

105. spacer 3.74|1744420|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

106. spacer 3.74|1744420|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

107. spacer 3.74|1744420|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

108. spacer 3.74|1744420|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

109. spacer 3.74|1744420|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

110. spacer 3.74|1744420|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

agccgatgtacttgctgactctgacgcgct	CRISPR spacer
taacgatgtacttgctgattctgaatcact	Protospacer
 . ***************.*****  *.**

111. spacer 3.76|1744516|30|NZ_CP014326|CRT matches to MF754113 (Vibrio phage vB_VpaS_KF3, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

112. spacer 3.76|1744516|30|NZ_CP014326|CRT matches to MF754114 (Vibrio phage vB_VpaS_KF4, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

113. spacer 3.80|1744708|30|NZ_CP014326|CRT matches to MF754113 (Vibrio phage vB_VpaS_KF3, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

114. spacer 3.80|1744708|30|NZ_CP014326|CRT matches to MF754114 (Vibrio phage vB_VpaS_KF4, complete genome) position: , mismatch: 7, identity: 0.767

ggcacttgtgcttgctgattggcttgcact	CRISPR spacer
gcttcttgtgcttgccgataggcttgcctt	Protospacer
* . ***********.*** ******* .*

115. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgtacttgttgatgctgaatcagatgcgct	Protospacer
.*.*************** ***** **   

116. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NZ_CP031076 (Bacillus mycoides strain BPN401 plasmid pl36, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
cattcttgttaattctgattcagaagcgaa	Protospacer
*.. ******.** ************* .*

117. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
agaaacagttgatgttgattctgaagctga	Protospacer
 * * . *******.****** ********

118. spacer 3.83|1744876|30|NZ_CP014326|CRT matches to NZ_AF135182 (Serratia entomophila strain A1MO2 plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgccgattcagaagctga	CRISPR spacer
ctgacgtgttgatgacgattcagaaggcaa	Protospacer
*  ** ******** *********** ..*

119. spacer 3.83|1744876|30|NZ_CP014326|CRT matches to NC_002523 (Serratia entomophila plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgccgattcagaagctga	CRISPR spacer
ctgacgtgttgatgacgattcagaaggcaa	Protospacer
*  ** ******** *********** ..*

120. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

121. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

122. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

123. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

124. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

125. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

126. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

127. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

128. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

129. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
****************** ** ** *.   

130. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgtacttgttgatgctgaatcagatgcgct	Protospacer
.*.*************** ***** **   

131. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NZ_CP031076 (Bacillus mycoides strain BPN401 plasmid pl36, complete sequence) position: , mismatch: 7, identity: 0.767

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
cattcttgttaattctgattcagaagcgaa	Protospacer
*.. ******.** ************* .*

132. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to MN693524 (Marine virus AFVG_25M219, complete genome) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattggctagctga	CRISPR spacer
tttacttgttgatgctgattggcttatcta	Protospacer
* .********************* ... *

133. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to MN693341 (Marine virus AFVG_25M304, complete genome) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattggctagctga	CRISPR spacer
tttacttgttgatgctgattggcttatcta	Protospacer
* .********************* ... *

134. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to MN693607 (Marine virus AFVG_25M305, complete genome) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattggctagctga	CRISPR spacer
tttacttgttgatgctgattggcttatcta	Protospacer
* .********************* ... *

135. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to KU236381 (Enterobacteria phage DT530 tail fiber protein AB gene, complete cds) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattggctagctga	CRISPR spacer
ccctatttctgatgctgattggcttgctga	Protospacer
. *  ** .*************** *****

136. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to NC_047749 (Enterobacteria phage DT571/2, complete genome) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattggctagctga	CRISPR spacer
ccctatttctgatgctgattggcttgctga	Protospacer
. *  ** .*************** *****

137. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to KM979354 (Enterobacteria phage DT57C, complete genome) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgctgattggctagctga	CRISPR spacer
ccctatttctgatgctgattggcttgctga	Protospacer
. *  ** .*************** *****

138. spacer 3.93|1745356|30|NZ_CP014326|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgtcgatgcggactggctagctga	CRISPR spacer
cgcacttgtcgatgcggcctggctggagcg	Protospacer
.**************** ******.*   .

139. spacer 3.94|1745404|30|NZ_CP014326|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgtcgatgcggactggctagctga	CRISPR spacer
cgcacttgtcgatgcggcctggctggagcg	Protospacer
.**************** ******.*   .

140. spacer 3.98|1745596|30|NZ_CP014326|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 7, identity: 0.767

tgcacttgttgatgccgattgactagccga	CRISPR spacer
ggctgccgttgatgccgattgactgggcga	Protospacer
 **  ..*****************.* ***

141. spacer 3.39|1742668|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

142. spacer 3.39|1742668|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

143. spacer 3.39|1742668|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

144. spacer 3.39|1742668|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

145. spacer 3.39|1742668|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

146. spacer 3.39|1742668|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

147. spacer 3.40|1742716|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

148. spacer 3.40|1742716|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

149. spacer 3.40|1742716|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

150. spacer 3.40|1742716|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

151. spacer 3.40|1742716|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

152. spacer 3.40|1742716|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

153. spacer 3.41|1742764|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

154. spacer 3.43|1742860|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

155. spacer 3.43|1742860|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

156. spacer 3.43|1742860|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

157. spacer 3.43|1742860|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

158. spacer 3.43|1742860|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

159. spacer 3.43|1742860|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

160. spacer 3.44|1742908|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

161. spacer 3.48|1743124|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agccgatgtgcttgctgattggcttgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

162. spacer 3.55|1743460|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgattggcttgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

163. spacer 3.57|1743556|30|NZ_CP014326|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.733

agccgatgtgcttgctgattggctcgcact	CRISPR spacer
actcgatgtgattgctgattgcctcgggga	Protospacer
* .******* ********** **** .  

164. spacer 3.57|1743556|30|NZ_CP014326|CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 8, identity: 0.733

agccgatgtgcttgctgattggctcgcact	CRISPR spacer
cattgacgtgcttgccgattggctcgccca	Protospacer
 ...**.********.*********** * 

165. spacer 3.57|1743556|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agccgatgtgcttgctgattggctcgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

166. spacer 3.58|1743604|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agccgatgtgcttgctgattggcttgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

167. spacer 3.62|1743820|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

168. spacer 3.62|1743820|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

169. spacer 3.62|1743820|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

170. spacer 3.62|1743820|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

171. spacer 3.62|1743820|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

172. spacer 3.62|1743820|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

173. spacer 3.63|1743868|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

174. spacer 3.63|1743868|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

175. spacer 3.63|1743868|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

176. spacer 3.63|1743868|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

177. spacer 3.63|1743868|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

178. spacer 3.63|1743868|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

179. spacer 3.64|1743916|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

180. spacer 3.64|1743916|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

181. spacer 3.64|1743916|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

182. spacer 3.64|1743916|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

183. spacer 3.64|1743916|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

184. spacer 3.64|1743916|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . *********************  *.  

185. spacer 3.65|1743964|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgattggctcgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

186. spacer 3.72|1744324|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agccgatgtgcttgctgattggcttgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

187. spacer 3.79|1744660|30|NZ_CP014326|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

agctgatgtgcttgctgattggcttgcact	CRISPR spacer
tgcggatgtccttgctgattggctgtccga	Protospacer
 ** ***** **************  *   

188. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

189. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

190. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

191. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

192. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

193. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

194. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

195. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

196. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

197. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

198. spacer 3.82|1744828|30|NZ_CP014326|CRT matches to MH616889 (Microviridae sp. isolate ctdc79, complete genome) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagctga	CRISPR spacer
tttgcctgttgatgatgattcagcagctgc	Protospacer
. ..*.******** ******** ***** 

199. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_LT571450 (Staphylococcus epidermidis isolate BPH0662 plasmid 2) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgacgctgattcgcttgcact	Protospacer
************.********.   **   

200. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_LT571450 (Staphylococcus epidermidis isolate BPH0662 plasmid 2) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgacgctgattcgcttgcact	Protospacer
************.********.   **   

201. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_LT571450 (Staphylococcus epidermidis isolate BPH0662 plasmid 2) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgacgctgattcgcttgcact	Protospacer
************.********.   **   

202. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatcgcttgcgct	Protospacer
****************** **.   **   

203. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatcgcttgcgct	Protospacer
****************** **.   **   

204. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_CP031076 (Bacillus mycoides strain BPN401 plasmid pl36, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
cattcttgttaattctgattcagaagcgaa	Protospacer
... ******.** ************* .*

205. spacer 3.89|1745164|30|NZ_CP014326|CRT matches to MN856028 (Myoviridae sp. isolate 287, complete genome) position: , mismatch: 8, identity: 0.733

cgcacttgttgacgctgattcagaggcact	CRISPR spacer
gaaaattgttgacggtgattcagaggttcc	Protospacer
 . * ********* ***********. *.

206. spacer 3.90|1745212|30|NZ_CP014326|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttgtcgatgctgactggctagctga	CRISPR spacer
cgcacttgtcgatgcggcctggctggagcg	Protospacer
.************** * ******.*   .

207. spacer 3.90|1745212|30|NZ_CP014326|CRT matches to MN693476 (Marine virus AFVG_25M323, complete genome) position: , mismatch: 8, identity: 0.733

tgcacttgtcgatgctgactggctagctga	CRISPR spacer
agttagggtcgatgctgactggctgtctga	Protospacer
 *.    *****************. ****

208. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

209. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

210. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

211. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NZ_CP023967 (Staphylococcus capitis strain FDAARGOS_378 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

212. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

213. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

214. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

215. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

216. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

217. spacer 3.91|1745260|30|NZ_CP014326|CRT matches to NC_013381 (Staphylococcus epidermidis plasmid SAP107A, complete sequence) position: , mismatch: 8, identity: 0.733

cgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcacttgttgatgctgaatctgatgtact	Protospacer
.***************** ** ** *.   

218. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattggctagctga	CRISPR spacer
tgcgcttgttgatgctgattgagttcatag	Protospacer
***.*****************. *   *..

219. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to MN693072 (Marine virus AFVG_25M5, complete genome) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattggctagctga	CRISPR spacer
tttacttattgatgcagattggctagtctt	Protospacer
* .****.******* **********..  

220. spacer 3.92|1745308|30|NZ_CP014326|CRT matches to MN693219 (Marine virus AFVG_25M370, complete genome) position: , mismatch: 8, identity: 0.733

tgcacttgttgatgctgattggctagctga	CRISPR spacer
tttacttattgatgcagattggctagtctt	Protospacer
* .****.******* **********..  

221. spacer 3.95|1745452|30|NZ_CP014326|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttatcgatgcggactggctagctga	CRISPR spacer
cgcacttgtcgatgcggcctggctggagcg	Protospacer
.******.********* ******.*   .

222. spacer 3.96|1745500|30|NZ_CP014326|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.733

tgcacttgtcgatgctgactggctagctga	CRISPR spacer
cgcacttgtcgatgcggcctggctggagcg	Protospacer
.************** * ******.*   .

223. spacer 3.96|1745500|30|NZ_CP014326|CRT matches to MN693476 (Marine virus AFVG_25M323, complete genome) position: , mismatch: 8, identity: 0.733

tgcacttgtcgatgctgactggctagctga	CRISPR spacer
agttagggtcgatgctgactggctgtctga	Protospacer
 *.    *****************. ****

224. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . ******.**************  *.  

225. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgacgtacttgctgactctgagtcaga	Protospacer
 . ***.*****************  *.  

226. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . ******.**************  *.  

227. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
tagtgatgtgcttgctgactctgagtcaga	Protospacer
 . ******.**************  *.  

228. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . ******.**************  *.  

229. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . ******.**************  *.  

230. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgatgtgcttgctgactctgagtcaga	Protospacer
 . ******.**************  *.  

231. spacer 3.42|1742812|30|NZ_CP014326|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

agctgatgtacttgctgactctgacgcgct	CRISPR spacer
taatgacgtacttgctgactctgagtcaga	Protospacer
 . ***.*****************  *.  

232. spacer 3.85|1744972|30|NZ_CP014326|CRT matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

tgcacttgttgatgctgattcagaagccga	CRISPR spacer
tgcgcttgttgatgctgattgagttcatag	Protospacer
***.**************** **    ...

233. spacer 3.99|1745644|30|NZ_CP014326|CRT matches to MN693341 (Marine virus AFVG_25M304, complete genome) position: , mismatch: 9, identity: 0.7

cgcacttgttgatgccgattggctagctga	CRISPR spacer
tttacttgttgatgctgattggcttatcta	Protospacer
. .************.******** ... *

234. spacer 3.99|1745644|30|NZ_CP014326|CRT matches to MN693219 (Marine virus AFVG_25M370, complete genome) position: , mismatch: 9, identity: 0.7

cgcacttgttgatgccgattggctagctga	CRISPR spacer
tttacttattgatgcagattggctagtctt	Protospacer
. .****.******* **********..  

235. spacer 3.99|1745644|30|NZ_CP014326|CRT matches to MN693607 (Marine virus AFVG_25M305, complete genome) position: , mismatch: 9, identity: 0.7

cgcacttgttgatgccgattggctagctga	CRISPR spacer
tttacttgttgatgctgattggcttatcta	Protospacer
. .************.******** ... *

236. spacer 3.99|1745644|30|NZ_CP014326|CRT matches to MN693072 (Marine virus AFVG_25M5, complete genome) position: , mismatch: 9, identity: 0.7

cgcacttgttgatgccgattggctagctga	CRISPR spacer
tttacttattgatgcagattggctagtctt	Protospacer
. .****.******* **********..  

237. spacer 3.99|1745644|30|NZ_CP014326|CRT matches to MN693524 (Marine virus AFVG_25M219, complete genome) position: , mismatch: 9, identity: 0.7

cgcacttgttgatgccgattggctagctga	CRISPR spacer
tttacttgttgatgctgattggcttatcta	Protospacer
. .************.******** ... *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4188 : 57791 61 Streptococcus_phage(88.68%) portal,holin,tail,capsid,protease,terminase,integrase,tRNA NA
DBSCAN-SWA_2 75873 : 87469 7 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 383981 : 437899 51 Streptococcus_phage(45.45%) protease,bacteriocin,tRNA,transposase NA
DBSCAN-SWA_4 691530 : 746766 51 Streptococcus_phage(41.67%) protease,holin,tRNA,transposase NA
DBSCAN-SWA_5 1086871 : 1206385 110 Streptococcus_phage(65.96%) integrase,bacteriocin,transposase attL 1088575:1088590|attR 1203839:1203855
DBSCAN-SWA_6 1385648 : 1394917 12 Streptococcus_phage(57.14%) tRNA NA
DBSCAN-SWA_7 1609518 : 1616276 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_8 1819304 : 1829490 10 Escherichia_phage(22.22%) NA NA
DBSCAN-SWA_9 2020442 : 2084206 47 Bacillus_phage(50.0%) protease,bacteriocin,tRNA,transposase NA
DBSCAN-SWA_10 2110254 : 2126418 21 Streptococcus_phage(76.92%) protease,integrase,capsid attL 2113307:2113320|attR 2125533:2125546
DBSCAN-SWA_11 2144589 : 2153363 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage