Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014344 Campylobacter jejuni strain RM3194 chromosome, complete genome 2 crisprs DEDDh,cas2,cas1,cas9,csa3 0 3 1 0
NZ_CP014345 Campylobacter jejuni strain RM3194 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP014344
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014344_1 1340068-1340147 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014344_2 1466396-1466563 TypeII NA
2 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014344_2 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder 1466432-1466461 30 MN530981 Campylobacter phage DA10, complete genome 33579-33608 0 1.0
NZ_CP014344_2 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder 1466432-1466461 30 KF751794 Campylobacter phage CJIE4-2, complete genome 13669-13698 0 1.0
NZ_CP014344_2 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder 1466432-1466461 30 KF751795 Campylobacter phage CJIE4-3, complete genome 11997-12026 0 1.0
NZ_CP014344_2 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder 1466432-1466461 30 KF751796 Campylobacter phage CJIE4-4, complete genome 12035-12064 0 1.0
NZ_CP014344_2 2.2|1466498|30|NZ_CP014344|CRISPRCasFinder 1466498-1466527 30 MN530981 Campylobacter phage DA10, complete genome 3548-3577 0 1.0
NZ_CP014344_2 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder 1466432-1466461 30 KF751797 Campylobacter phage CJIE4-5, complete genome 13919-13948 1 0.967
NZ_CP014344_2 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder 1466432-1466461 30 KF751793 Campylobacter phage CJIE4-1, complete genome 14946-14975 1 0.967
NZ_CP014344_1 1.1|1340091|34|NZ_CP014344|CRISPRCasFinder 1340091-1340124 34 MH752385 Bacillus phage Ray17, complete genome 8509-8542 10 0.706

1. spacer 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 0, identity: 1.0

ccatcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
******************************

2. spacer 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder matches to KF751794 (Campylobacter phage CJIE4-2, complete genome) position: , mismatch: 0, identity: 1.0

ccatcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
******************************

3. spacer 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder matches to KF751795 (Campylobacter phage CJIE4-3, complete genome) position: , mismatch: 0, identity: 1.0

ccatcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
******************************

4. spacer 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder matches to KF751796 (Campylobacter phage CJIE4-4, complete genome) position: , mismatch: 0, identity: 1.0

ccatcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccatcaagtcgtgcaattttaatacactgg	Protospacer
******************************

5. spacer 2.2|1466498|30|NZ_CP014344|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 0, identity: 1.0

ttagcaacttataataactctaatgttatt	CRISPR spacer
ttagcaacttataataactctaatgttatt	Protospacer
******************************

6. spacer 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder matches to KF751797 (Campylobacter phage CJIE4-5, complete genome) position: , mismatch: 1, identity: 0.967

ccatcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

7. spacer 2.1|1466432|30|NZ_CP014344|CRISPRCasFinder matches to KF751793 (Campylobacter phage CJIE4-1, complete genome) position: , mismatch: 1, identity: 0.967

ccatcaagtcgtgcaattttaatacactgg	CRISPR spacer
ccttcaagtcgtgcaattttaatacactgg	Protospacer
** ***************************

8. spacer 1.1|1340091|34|NZ_CP014344|CRISPRCasFinder matches to MH752385 (Bacillus phage Ray17, complete genome) position: , mismatch: 10, identity: 0.706

ttttttagctttatactcagccttactcatataa	CRISPR spacer
cttacaagctttatactcagccttattgatcgtt	Protospacer
.** . *******************.* **    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1368783 : 1374719 6 Acanthamoeba_polyphaga_mimivirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage