Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013667 Coxiella burnetii strain 3262 chromosome, complete genome 1 crisprs cas5f,cas7f,cas6f,DEDDh,cas3 0 1 9 0
NZ_CP013668 Coxiella burnetii strain 3262 plasmid QpH1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP013667
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013667_1 1347289-1347370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013667_1 1.1|1347314|32|NZ_CP013667|CRISPRCasFinder 1347314-1347345 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 767068-767099 8 0.75

1. spacer 1.1|1347314|32|NZ_CP013667|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgtccttcggcgaggcctctttcgaaacc	CRISPR spacer
tgcctcgcttcggcgaggcctctttcgcaaca	Protospacer
. .* . ******************** *** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 500356 : 569918 60 Streptococcus_phage(40.0%) transposase NA
DBSCAN-SWA_2 687083 : 737607 50 Streptococcus_phage(71.43%) transposase,protease NA
DBSCAN-SWA_3 743223 : 795316 51 Streptococcus_phage(45.45%) transposase,holin,tRNA NA
DBSCAN-SWA_4 805692 : 855272 50 Streptococcus_phage(42.86%) transposase,tRNA NA
DBSCAN-SWA_5 866745 : 933714 59 Streptococcus_phage(40.0%) transposase,protease,tRNA NA
DBSCAN-SWA_6 1084544 : 1142841 56 Streptococcus_phage(35.71%) transposase,protease,tRNA NA
DBSCAN-SWA_7 1305026 : 1348106 47 Streptococcus_phage(25.0%) transposase,tRNA NA
DBSCAN-SWA_8 1612847 : 1675400 57 Streptococcus_phage(18.18%) transposase,protease,tRNA NA
DBSCAN-SWA_9 2071315 : 2080235 11 uncultured_Mediterranean_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage