Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014514 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence 0 crisprs PD-DExK,WYL 0 0 1 0
NZ_CP014516 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014515 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014513 Frondihabitans sp. PAMC 28766 strain SR6 chromosome, complete genome 9 crisprs csa3,WYL,cas3,DEDDh,RT 0 2 0 0

Results visualization

1. NZ_CP014514
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1038 : 60710 47 Escherichia_phage(16.67%) integrase,transposase attL 49378:49393|attR 54233:54248

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014513
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_1 1287553-1287637 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_2 1364736-1364832 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_3 1941299-1941391 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_4 1970990-1971126 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_5 2114768-2114847 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_6 2729098-2729204 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_7 2957322-2957431 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_8 2973243-2973345 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014513_9 3858952-3859091 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP047181 Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence 38560-38590 6 0.806
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP047184 Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence 28657-28687 6 0.806
NZ_CP014513_5 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder 2114793-2114822 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 53874-53903 6 0.8
NZ_CP014513_5 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder 2114793-2114822 30 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 63538-63567 6 0.8
NZ_CP014513_5 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder 2114793-2114822 30 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 70013-70042 6 0.8
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 206406-206436 7 0.774
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 13509-13539 7 0.774
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1569399-1569429 7 0.774
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1569529-1569559 7 0.774
NZ_CP014513_5 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder 2114793-2114822 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1112852-1112881 7 0.767
NZ_CP014513_5 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder 2114793-2114822 30 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 24034-24063 7 0.767
NZ_CP014513_5 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder 2114793-2114822 30 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1037839-1037868 7 0.767
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP023550 Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence 105989-106019 8 0.742
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 499113-499143 8 0.742
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1283522-1283552 8 0.742
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 MK801727 Gordonia phage ThankyouJordi, complete genome 49559-49589 8 0.742
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 MK875793 Gordonia phage WelcomeAyanna, complete genome 49706-49736 8 0.742
NZ_CP014513_2 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder 1364769-1364799 31 NZ_CP011274 Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence 75017-75047 9 0.71

1. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP047181 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
aaggccggcggcgggttcgggatagcgatcg	Protospacer
**************** ***** . **.* *

2. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
aaggccggcggcgggttcgggatagcgatcg	Protospacer
**************** ***** . **.* *

3. spacer 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.8 

ggagccgaacggccgaggcccggcagcggc	CRISPR spacer
agatcaccccggccgaggcccggcagcggc	Protospacer
.** *    *********************

4. spacer 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 6, identity: 0.8 

ggagccg--aacggccgaggcccggcagcggc	CRISPR spacer
--ccccgacaacggacggggcccggcagcggc	Protospacer
    ***  ***** **.**************

5. spacer 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 6, identity: 0.8 

ggagccg--aacggccgaggcccggcagcggc	CRISPR spacer
--ctccgacaacggacggggcccggcagcggc	Protospacer
    ***  ***** **.**************

6. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.774 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
gctgccagcggcgggggcgggaggccggccg	Protospacer
.  ***.******** ************. *

7. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 7, identity: 0.774 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
cgagccggctgcgggtgcgggcggccgggcg	Protospacer
 ..****** *********** ******  *

8. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
acggccggcggcgggtgccggcggcggcgcg	Protospacer
* **************** ** *** *   *

9. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
acggccggcggcgggtgccggcggcggcgcg	Protospacer
* **************** ** *** *   *

10. spacer 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767 

ggagccgaacggccgaggcccggcagcggc	CRISPR spacer
agatcaccccggccgaggcgcggcagcggc	Protospacer
.** *    ********** **********

11. spacer 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 7, identity: 0.767 

ggagccgaacggccgaggcccggcagcggc	CRISPR spacer
ggagccggacggccgtggcccgggcgagaa	Protospacer
*******.******* *******  * *.

12. spacer 5.1|2114793|30|NZ_CP014513|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 7, identity: 0.767 

ggagccgaacggccgaggcccggcagcggc	CRISPR spacer
cgatgcgcacggccgaggcccggctgcgca	Protospacer
 **  ** **************** ***

13. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
caggccggcggcggttgcaggaggcaatcag	Protospacer
 ************* ***.****** . ..*

14. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
cgtaccggcggcgggcgctggaggccgtggg	Protospacer
 . .***********.** ********  **

15. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
ctggccggcggcgggttcgggacgcggaacg	Protospacer
  ************** ***** ** *.  *

16. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to MK801727 (Gordonia phage ThankyouJordi, complete genome) position: , mismatch: 8, identity: 0.742 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
gacttcggcggcgggtgcgggttgccgggcg	Protospacer
.*  .****************  *****  *

17. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to MK875793 (Gordonia phage WelcomeAyanna, complete genome) position: , mismatch: 8, identity: 0.742 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
gacttcggcggcgggtgcgggttgccgggcg	Protospacer
.*  .****************  *****  *

18. spacer 2.1|1364769|31|NZ_CP014513|CRISPRCasFinder matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 9, identity: 0.71 

aaggccggcggcgggtgcgggaggccggtgg	CRISPR spacer
tcgtgcggcggcggggccgggaggccggctt	Protospacer
  *  **********  ***********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage