Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014566 Mycobacterium tuberculosis variant bovis BCG str. Tokyo 172 chromosome, complete genome 14 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6 8 33 0 0

Results visualization

1. NZ_CP014566
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_1 332008-332805 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_2 693271-693347 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_3 928759-929670 Orphan NA
19 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_4 930607-930736 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_5 1214586-1215442 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_6 1634721-1634958 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_7 2071233-2071487 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_8 2152964-2153089 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_9 3065406-3066833 TypeIII II-B,III-A
19 spacers
cas2,cas1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_10 3068156-3070326 TypeIII II-B,III-A
29 spacers
cas2,cas1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_11 3747955-3748081 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_13 4064777-4064855 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_12 4064375-4064700 Unclear NA
5 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014566_14 4081037-4081125 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 835329-835355 0 1.0
NZ_CP014566_5 5.8|1215014|16|NZ_CP014566|CRISPRCasFinder 1215014-1215029 16 NZ_CP014566.1 2071548-2071563 0 1.0
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 971944-971965 0 1.0
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 331954-331980 1 0.963
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 334968-334994 1 0.963
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 337914-337940 1 0.963
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 841580-841606 1 0.963
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 842858-842884 1 0.963
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 928492-928518 1 0.963
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 2396442-2396468 1 0.963
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 335363-335381 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 676017-676035 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 841412-841430 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1220379-1220397 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1220451-1220469 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1628384-1628402 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1631210-1631228 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1634068-1634086 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1974182-1974200 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2044529-2044547 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2045075-2045093 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2758665-2758683 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2762185-2762203 1 0.947
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3910392-3910410 1 0.947
NZ_CP014566_7 7.2|2071314|18|NZ_CP014566|CRT 2071314-2071331 18 NZ_CP014566.1 402323-402340 1 0.944
NZ_CP014566_7 7.2|2071314|18|NZ_CP014566|CRT 2071314-2071331 18 NZ_CP014566.1 608571-608588 1 0.944
NZ_CP014566_7 7.4|2071404|18|NZ_CP014566|CRT 2071404-2071421 18 NZ_CP014566.1 3397334-3397351 1 0.944
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 339370-339391 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1842550-1842571 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 2396818-2396839 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3723109-3723130 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3923669-3923690 1 0.955
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 333190-333216 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 335919-335945 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 336258-336284 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 339033-339059 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 676345-676371 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 838701-838727 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 839799-839825 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 928393-928419 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 1216511-1216537 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 1653655-1653681 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 1842867-1842893 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 2044347-2044373 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 3787879-3787905 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 3918131-3918157 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014566.1 3918287-3918313 2 0.926
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP014566.1 2917754-2917775 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP014566.1 2917820-2917841 2 0.909
NZ_CP014566_5 5.11|1215152|22|NZ_CP014566|CRISPRCasFinder 1215152-1215173 22 NZ_CP014566.1 839163-839184 2 0.909
NZ_CP014566_5 5.11|1215152|22|NZ_CP014566|CRISPRCasFinder 1215152-1215173 22 NZ_CP014566.1 1220406-1220427 2 0.909
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 150233-150251 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 333354-333372 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 336470-336488 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 336923-336941 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 336974-336992 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 336983-337001 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 339254-339272 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 339374-339392 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 339641-339659 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 339688-339706 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 339764-339782 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 364340-364358 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 444555-444573 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 547899-547917 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 625226-625244 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 625448-625466 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 675183-675201 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 842360-842378 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1093118-1093136 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1093766-1093784 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1097818-1097836 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1215641-1215659 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1216148-1216166 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1216400-1216418 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1216418-1216436 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1220799-1220817 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1488591-1488609 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1616336-1616354 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1616789-1616807 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1633933-1633951 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1633942-1633960 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1634155-1634173 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1634206-1634224 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1842452-1842470 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1842980-1842998 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1973456-1973474 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 1984435-1984453 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2071743-2071761 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2279921-2279939 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2331171-2331189 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2392398-2392416 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2396363-2396381 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2539046-2539064 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2651341-2651359 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2751981-2751999 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 2752563-2752581 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3001051-3001069 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3001150-3001168 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3691981-3691999 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3723113-3723131 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3723737-3723755 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3723980-3723998 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3724112-3724130 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3726017-3726035 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3786460-3786478 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3786643-3786661 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3907825-3907843 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3909564-3909582 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3910218-3910236 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 3918509-3918527 2 0.895
NZ_CP014566_5 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder 1215269-1215287 19 NZ_CP014566.1 4007962-4007980 2 0.895
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 335173-335194 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 335359-335380 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 336466-336487 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 336970-336991 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 339064-339085 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 673730-673751 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 675179-675200 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 841260-841281 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 930524-930545 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 971464-971485 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1093119-1093140 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1192057-1192078 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1194259-1194280 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1488587-1488608 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1973599-1973620 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1974829-1974850 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 1985225-1985246 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 2044879-2044900 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 2761157-2761178 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3109534-3109555 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3726013-3726034 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3764559-3764580 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3911980-3912001 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3912304-3912325 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3912901-3912922 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3913525-3913546 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3918576-3918597 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 3920670-3920691 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 4007859-4007880 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP014566.1 4007958-4007979 2 0.909

1. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 835329-835355, mismatch: 0, identity: 1.0

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggtaacggcgg	Protospacer
***************************

2. spacer 5.8|1215014|16|NZ_CP014566|CRISPRCasFinder matches to position: 2071548-2071563, mismatch: 0, identity: 1.0

gtggctgtacggcgac	CRISPR spacer
gtggctgtacggcgac	Protospacer
****************

3. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 971944-971965, mismatch: 0, identity: 1.0

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagccggcggcagcg	Protospacer
**********************

4. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 331954-331980, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

5. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 334968-334994, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

6. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 337914-337940, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

7. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 841580-841606, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

8. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 842858-842884, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

9. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 928492-928518, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

10. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 2396442-2396468, mismatch: 1, identity: 0.963

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcgg	Protospacer
******************.********

11. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 335363-335381, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

12. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 676017-676035, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggtggc	Protospacer
******.************

13. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 841412-841430, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

14. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1220379-1220397, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

15. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1220451-1220469, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

16. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1628384-1628402, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggtggc	Protospacer
********* *********

17. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1631210-1631228, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

18. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1634068-1634086, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

19. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1974182-1974200, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

20. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2044529-2044547, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

21. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2045075-2045093, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

22. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2758665-2758683, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggtggc	Protospacer
** ****************

23. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2762185-2762203, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggtggc	Protospacer
************ ******

24. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3910392-3910410, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggtggc	Protospacer
***.***************

25. spacer 7.2|2071314|18|NZ_CP014566|CRT matches to position: 402323-402340, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

26. spacer 7.2|2071314|18|NZ_CP014566|CRT matches to position: 608571-608588, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

27. spacer 7.4|2071404|18|NZ_CP014566|CRT matches to position: 3397334-3397351, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

28. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 339370-339391, mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

29. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1842550-1842571, mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcagcg	Protospacer
********.*************

30. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 2396818-2396839, mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcagcg	Protospacer
********.*************

31. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3723109-3723130, mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

32. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3923669-3923690, mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcagcg	Protospacer
********.*************

33. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 333190-333216, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaacggcggcaacggcgg	Protospacer
** ***************.********

34. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 335919-335945, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacggcgg	Protospacer
**** *************.********

35. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 336258-336284, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggtaacggcggcaacggcgg	Protospacer
*********.********.********

36. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 339033-339059, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaatggcggtaacggtgg	Protospacer
************.***********.**

37. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 676345-676371, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcgg	Protospacer
****** ***********.********

38. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 838701-838727, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacgccgg	Protospacer
******************.**** ***

39. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 839799-839825, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaccggcggcaacggcgg	Protospacer
*********** ******.********

40. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 928393-928419, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggtgg	Protospacer
******************.*****.**

41. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 1216511-1216537, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcgg	Protospacer
******************. *******

42. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 1653655-1653681, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggtaacggcggtgacggcgg	Protospacer
*********.*********.*******

43. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 1842867-1842893, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcgggaacggcgg	Protospacer
**** ************* ********

44. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 2044347-2044373, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcgacggcggtgacggcgg	Protospacer
**********.********.*******

45. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 3787879-3787905, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctcatcggcaacggcggcaacggcgg	Protospacer
*** **************.********

46. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 3918131-3918157, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgctcggcaacggcggtatcggcgg	Protospacer
**** *************** ******

47. spacer 3.19|929626|27|NZ_CP014566|CRT matches to position: 3918287-3918313, mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgctcggcaacggcggcaacggcgg	Protospacer
**** *************.********

48. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to position: 2917754-2917775, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

49. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to position: 2917820-2917841, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

50. spacer 5.11|1215152|22|NZ_CP014566|CRISPRCasFinder matches to position: 839163-839184, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgccggtggggcc	Protospacer
*********** ****** ***

51. spacer 5.11|1215152|22|NZ_CP014566|CRISPRCasFinder matches to position: 1220406-1220427, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgtcggtggcgcc	Protospacer
*********** ******.***

52. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 150233-150251, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcggcggtggc	Protospacer
********* * *******

53. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 333354-333372, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

54. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 336470-336488, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

55. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 336923-336941, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggctggcggc	Protospacer
************.**.***

56. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 336974-336992, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

57. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 336983-337001, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

58. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 339254-339272, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

59. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 339374-339392, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

60. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 339641-339659, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggtcggtggc	Protospacer
** ********.*******

61. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 339688-339706, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgccgccggtggc	Protospacer
********  *********

62. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 339764-339782, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

63. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 364340-364358, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcggcgccggtggc	Protospacer
***** *** *********

64. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 444555-444573, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggacggtggc	Protospacer
** ******** *******

65. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 547899-547917, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggccgggccggtggc	Protospacer
** **** ***********

66. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 625226-625244, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

67. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 625448-625466, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

68. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 675183-675201, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

69. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 842360-842378, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

70. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1093118-1093136, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

71. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1093766-1093784, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggaggggccggcggc	Protospacer
****** ********.***

72. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1097818-1097836, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

73. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1215641-1215659, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggaggc	Protospacer
******.******** ***

74. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1216148-1216166, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

75. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1216400-1216418, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

76. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1216418-1216436, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

77. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1220799-1220817, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

78. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1488591-1488609, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

79. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1616336-1616354, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

80. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1616789-1616807, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggagccggtggc	Protospacer
******.**.*********

81. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1633933-1633951, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggcgccggtggc	Protospacer
******.** *********

82. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1633942-1633960, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

83. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1634155-1634173, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

84. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1634206-1634224, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

85. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1842452-1842470, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

86. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1842980-1842998, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

87. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1973456-1973474, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

88. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 1984435-1984453, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgtcggcggtgccggtggc	Protospacer
**.****** *********

89. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2071743-2071761, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

90. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2279921-2279939, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgtcggc	Protospacer
************** .***

91. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2331171-2331189, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

92. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2392398-2392416, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggtcgatggc	Protospacer
***********.**.****

93. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2396363-2396381, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

94. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2539046-2539064, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

95. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2651341-2651359, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

96. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2751981-2751999, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcaggcggtgccggtggc	Protospacer
*** ***** *********

97. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 2752563-2752581, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

98. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3001051-3001069, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

99. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3001150-3001168, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

100. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3691981-3691999, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcgggcccggtggc	Protospacer
***** **** ********

101. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3723113-3723131, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

102. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3723737-3723755, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgcaggtggc	Protospacer
********* ** ******

103. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3723980-3723998, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggtgccggtggc	Protospacer
******.** *********

104. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3724112-3724130, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

105. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3726017-3726035, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

106. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3786460-3786478, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

107. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3786643-3786661, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

108. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3907825-3907843, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccagcggggccggcggc	Protospacer
****.**********.***

109. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3909564-3909582, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

110. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3910218-3910236, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgcgggtggc	Protospacer
********* ** ******

111. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 3918509-3918527, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggcacggtggc	Protospacer
**********  *******

112. spacer 5.13|1215269|19|NZ_CP014566|CRISPRCasFinder matches to position: 4007962-4007980, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

113. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 335173-335194, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

114. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 335359-335380, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

115. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 336466-336487, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcaacg	Protospacer
******** **********.**

116. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 336970-336991, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcggcg	Protospacer
******** *********.***

117. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 339064-339085, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggaagcg	Protospacer
******** ******** ****

118. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 673730-673751, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggtgccggcggcaccg	Protospacer
******** ********** **

119. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 675179-675200, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcaacg	Protospacer
******** **********.**

120. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 841260-841281, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

121. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 930524-930545, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagctggcggcaccg	Protospacer
***********.******* **

122. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 971464-971485, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gctggcggcgccggcggcagcg	Protospacer
**.***** *************

123. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1093119-1093140, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcaacg	Protospacer
******** **********.**

124. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1192057-1192078, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagccggcgccaacg	Protospacer
**************** **.**

125. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1194259-1194280, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagccggcgccaacg	Protospacer
**************** **.**

126. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1488587-1488608, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggtgccggcggcaccg	Protospacer
******** ********** **

127. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1973599-1973620, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gctggcggcgccggcggcagcg	Protospacer
**.***** *************

128. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1974829-1974850, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagccggcggtaacg	Protospacer
*****************.*.**

129. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 1985225-1985246, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcatcg	Protospacer
******** ********** **

130. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 2044879-2044900, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaccg	Protospacer
********.********** **

131. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 2761157-2761178, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggtgccggcggcaacg	Protospacer
******** **********.**

132. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3109534-3109555, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcaacg	Protospacer
******** **********.**

133. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3726013-3726034, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggtgccggcggcaacg	Protospacer
******** **********.**

134. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3764559-3764580, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggtggcgccggcggcagcg	Protospacer
*****.** *************

135. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3911980-3912001, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaccg	Protospacer
********.********** **

136. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3912304-3912325, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

137. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3912901-3912922, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

138. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3913525-3913546, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

139. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3918576-3918597, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggggccggcggcaacg	Protospacer
********.**********.**

140. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 3920670-3920691, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gcgggcggcgccggcggcagcg	Protospacer
** ***** *************

141. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 4007859-4007880, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcaacg	Protospacer
******** **********.**

142. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to position: 4007958-4007979, mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggtgccggcggcatcg	Protospacer
******** ********** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136911 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 302856-302877 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH371116 Mycobacterium phage DMoney, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH045569 Mycobacterium phage Schiebel, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH371119 Mycobacterium phage OctaviousRex, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MF919497 Mycobacterium phage Chance64, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH001456 Mycobacterium phage CLED96, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 GQ303261 Mycobacterium phage Hope, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MG099946 Mycobacterium phage LouisV14, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MN234183 Mycobacterium phage Antsirabe, complete genome 24404-24425 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787112 Mycobacterium phage Clark, partial genome 20778-20799 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH779513 Mycobacterium phage Olga, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK919475 Mycobacterium phage Camri, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK310146 Mycobacterium phage Crespo, complete genome 21748-21769 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK524493 Mycobacterium phage Darionha, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH779505 Mycobacterium phage Grizzly, complete genome 21751-21772 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 EU568876 Mycobacterium phage BPs, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787107 Mycobacterium phage Bo4, complete genome 17813-17834 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MF668268 Mycobacterium phage Aroostook, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KX588251 Mycobacterium phage Jane, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787103 Mycobacterium phage Chy2, partial genome 20253-20274 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH001455 Mycobacterium phage Remy19, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KP087941 Eel River basin pequenovirus isolate c10494, complete genome 3913-3934 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KT355472 Mycobacterium phage Cedasite, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KX664455 Mycobacterium phage Zombie, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH077584 Mycobacterium phage Phish, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787108 Mycobacterium phage DNAIII, complete genome 21498-21519 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MN444875 Mycobacterium phage Jonghyun, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK433279 Mycobacterium phage Kareem, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KJ725374 Mycobacterium phage Guo1, complete genome 12341-12362 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MT818422 Mycobacterium phage Periodt, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK305884 Mycobacterium phage BQuat, complete genome 21738-21759 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MF668272 Mycobacterium phage Gideon, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH779515 Mycobacterium phage Sweets, complete genome 21742-21763 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MW119570 Mycobacterium phage Lang, complete genome 21821-21842 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787104 Mycobacterium phage Chy3, partial genome 21868-21889 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NC_012788 Mycobacterium phage Angel, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KX443326 Mycobacterium phage BruceB, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK433277 Mycobacterium phage Renaissance, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH590605 Mycobacterium phage Cherrybomb426, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH779509 Mycobacterium phage Kasen3, complete genome 21748-21769 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 JN699002 Mycobacterium phage Avrafan, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH779507 Mycobacterium phage Hotshotbaby7, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KT355474 Mycobacterium phage Frosty24, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787109 Mycobacterium phage Legendre, partial genome 19229-19250 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 JN412593 Mycobacterium phage Liefie, complete genome 21746-21767 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH479920 Mycobacterium phage Mowgli, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NC_008202 Mycobacterium phage Halo, complete genome 21742-21763 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KM923970 Mycobacterium phage Gomashi, complete genome 21748-21769 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH450127 Mycobacterium phage Plagueis, complete genome 21582-21603 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KT347314 Mycobacterium phage Phreak, complete genome 21747-21768 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KT365399 Mycobacterium phage Annihilator, complete genome 21738-21759 1 0.955
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 KC787110 Mycobacterium phage Leo, complete genome 21505-21526 1 0.955
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 KY087993 Mycobacterium phage Hammy, complete genome 24359-24385 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24472 2 0.926
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MF140406 Mycobacterium phage DarthP, complete genome 24368-24394 2 0.926
NZ_CP014566_4 4.1|930632|23|NZ_CP014566|PILER-CR 930632-930654 23 NZ_CP049042 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_5, complete sequence 64431-64453 2 0.913
NZ_CP014566_4 4.1|930632|23|NZ_CP014566|PILER-CR 930632-930654 23 NZ_CP045388 Ruegeria sp. THAF33 plasmid pTHAF33_d, complete sequence 32904-32926 2 0.913
NZ_CP014566_4 4.1|930632|23|NZ_CP014566|PILER-CR 930632-930654 23 NZ_CP020932 Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence 48558-48580 2 0.913
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 794580-794601 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 75477-75498 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 713470-713491 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 56975-56996 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 458462-458483 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1354617-1354638 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 881389-881410 2 0.909
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_047977 Microbacterium phage Hendrix, complete genome 3065-3086 2 0.909
NZ_CP014566_5 5.15|1215353|22|NZ_CP014566|CRISPRCasFinder 1215353-1215374 22 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 917429-917450 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MF919497 Mycobacterium phage Chance64, complete genome 24927-24948 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MF668268 Mycobacterium phage Aroostook, complete genome 24927-24948 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MN444875 Mycobacterium phage Jonghyun, complete genome 24927-24948 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MT818422 Mycobacterium phage Periodt, complete genome 24927-24948 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MF668272 Mycobacterium phage Gideon, complete genome 24927-24948 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MH779507 Mycobacterium phage Hotshotbaby7, complete genome 24927-24948 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 133405-133426 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 666682-666703 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 722266-722287 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 597018-597039 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 922651-922672 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1081343-1081364 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1049686-1049707 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 824050-824071 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MK524494 Mycobacterium phage Rabbs, complete genome 25010-25031 2 0.909
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 NC_031102 Mycobacterium phage Sneeze, complete genome 25009-25030 2 0.909
NZ_CP014566_1 1.11|332581|27|NZ_CP014566|CRT 332581-332607 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5507414-5507440 3 0.889
NZ_CP014566_1 1.11|332581|27|NZ_CP014566|CRT 332581-332607 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 756232-756258 3 0.889
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5584 3 0.889
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 174571-174597 3 0.889
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MN549360 Rhizobium phage RL38J1, complete genome 66420-66446 3 0.889
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 MN703413 Arthrobacter phage Powerpuff, complete genome 38834-38858 3 0.88
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 MT024871 Arthrobacter phage YesChef, complete genome 37693-37717 3 0.88
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 355111-355132 3 0.864
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 58695-58716 3 0.864
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 90623-90644 3 0.864
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1457966-1457987 3 0.864
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 422944-422965 3 0.864
NZ_CP014566_5 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder 1214969-1214990 22 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 3900-3921 3 0.864
NZ_CP014566_5 5.11|1215152|22|NZ_CP014566|CRISPRCasFinder 1215152-1215173 22 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 4076-4097 3 0.864
NZ_CP014566_7 7.5|2071443|24|NZ_CP014566|CRT 2071443-2071466 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NZ_CP014566_7 7.5|2071443|24|NZ_CP014566|CRT 2071443-2071466 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NZ_CP014566_12 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder 4064400-4064421 22 MN857473 Teseptimavirus S2B, complete genome 6680-6701 3 0.864
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT723940 Mycobacterium phage Ellie, complete genome 24126-24152 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MG198783 Gordonia phage Mahdia, complete genome 21931-21957 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_023067 Streptomyces sp. F2 plasmid pFP3, complete sequence 30855-30881 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP011274 Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence 78443-78469 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83951-83977 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1813514-1813540 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1820602-1820628 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 454199-454225 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1694896-1694922 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT889380 Mycobacterium phage Coco12, complete genome 22836-22862 4 0.852
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22517 4 0.852
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 9745-9769 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1906386-1906410 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 794756-794780 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 34847-34871 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1665271-1665295 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 15832-15856 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 348896-348920 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 406425-406449 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 26065-26089 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 450297-450321 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NC_022437 Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence 16147-16171 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1382131-1382155 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1418915-1418939 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 118938-118962 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1711697-1711721 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 722328-722352 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 67000-67024 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 118938-118962 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1149411-1149435 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 438623-438647 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 243636-243660 4 0.84
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1410063-1410087 4 0.84
NZ_CP014566_7 7.5|2071443|24|NZ_CP014566|CRT 2071443-2071466 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NZ_CP014566_7 7.5|2071443|24|NZ_CP014566|CRT 2071443-2071466 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NZ_CP014566_7 7.5|2071443|24|NZ_CP014566|CRT 2071443-2071466 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NZ_CP014566_1 1.2|332101|27|NZ_CP014566|CRT 332101-332127 27 MN103533 Mycobacterium phage Weirdo19, complete genome 26901-26927 5 0.815
NZ_CP014566_1 1.11|332581|27|NZ_CP014566|CRT 332581-332607 27 MK415400 Phage apr34_1784, complete genome 5470-5496 5 0.815
NZ_CP014566_1 1.11|332581|27|NZ_CP014566|CRT 332581-332607 27 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 161455-161481 5 0.815
NZ_CP014566_1 1.11|332581|27|NZ_CP014566|CRT 332581-332607 27 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 35634-35660 5 0.815
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 201261-201290 5 0.833
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 KM389325 UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence 195-224 5 0.833
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 519541-519570 5 0.833
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 734-763 5 0.833
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 295647-295676 5 0.833
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 416946-416975 5 0.833
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 KX683875 Mycobacterium phage Baehexic, complete genome 12181-12207 5 0.815
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 KM197169 Mycobacterium phage Piro94, complete genome 12178-12204 5 0.815
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 MF668269 Mycobacterium phage Drake55, complete genome 12177-12203 5 0.815
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 MK284522 Mycobacterium phage Malec, complete genome 11950-11976 5 0.815
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 KM677210 Mycobacterium phage Larenn, complete genome 11945-11971 5 0.815
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 94545-94574 5 0.833
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 243155-243184 5 0.833
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NZ_CP014566_3 3.18|929584|24|NZ_CP014566|CRT 929584-929607 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3050221-3050247 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 351029-351055 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 67859-67885 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 13686-13712 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 141160-141186 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 107345-107371 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 76100-76126 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 954137-954163 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 954235-954261 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 957327-957353 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 3110-3136 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 637890-637916 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 282741-282767 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 11750-11776 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK814754 Mycobacterium phage Sumter, complete genome 28141-28167 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK814754 Mycobacterium phage Sumter, complete genome 28639-28665 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22614 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24840 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MH001451 Mycobacterium phage Nairb, complete genome 21242-21268 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25566 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24988 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28502 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21268 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 KF614509 Rhizobium phage vB_RleS_L338C, complete genome 100818-100844 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24988 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24855 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21268 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21268 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24663 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21268 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MN735432 Mycobacteriophage Whitty, complete genome 21242-21268 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1425048-1425074 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 326423-326449 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1547236-1547262 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1481197-1481223 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1347491-1347517 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 537266-537292 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1492767-1492793 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1409701-1409727 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1346513-1346539 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1391887-1391913 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1391878-1391904 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1347483-1347509 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1346836-1346862 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1347474-1347500 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1486112-1486138 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1425194-1425220 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1175053-1175079 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 90307-90333 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1425176-1425202 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1425161-1425187 5 0.815
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT778840 Rhizobium phage P11VFA, complete genome 100109-100135 5 0.815
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MG925349 Mycobacterium phage Mendokysei, complete genome 21052-21085 5 0.853
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3841167-3841191 5 0.8
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 157500-157524 5 0.8
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 179155-179179 5 0.8
NZ_CP014566_5 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder 1214789-1214813 25 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 67026-67050 5 0.8
NZ_CP014566_1 1.3|332146|30|NZ_CP014566|CRT 332146-332175 30 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 57659-57688 6 0.8
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 586980-587009 6 0.8
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 453093-453122 6 0.8
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 236156-236185 6 0.8
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 658647-658673 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 NC_023606 Mycobacterium phage CRB1, complete genome 11649-11675 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 MK524491 Mycobacterium phage Whabigail7, complete genome 12139-12165 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 KX619650 Mycobacterium phage Jerm, complete genome 12089-12115 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 MN585998 Mycobacterium phage Bugsy, complete genome 12128-12154 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 JN408460 Mycobacterium phage Turbido, complete genome 12151-12177 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 MH077576 Mycobacterium phage AbbyPaige, complete genome 12129-12155 6 0.778
NZ_CP014566_3 3.5|929005|27|NZ_CP014566|CRT 929005-929031 27 MH825704 Mycobacterium phage LilTurb, complete genome 12148-12174 6 0.778
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1925675-1925704 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 2140117-2140146 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1976527-1976556 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1925852-1925881 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1976547-1976576 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1976525-1976554 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1925295-1925324 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1925239-1925268 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 2068574-2068603 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 94975-95004 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 2026793-2026822 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 176045-176074 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 94722-94751 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 165131-165160 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 50987-51016 6 0.8
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 460274-460303 6 0.8
NZ_CP014566_3 3.12|929299|27|NZ_CP014566|CRT 929299-929325 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211450-2211476 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350669-350695 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3465308-3465334 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 750706-750732 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455044-455070 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25156-25182 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1244998-1245024 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52121 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 282903-282929 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT939492 Xanthomonas phage Xoo-sp14, complete genome 88792-88818 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MF919498 Mycobacterium phage Cindaradix, complete genome 3036-3062 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 KR997929 Mycobacterium phage Barriga, complete genome 28338-28364 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MH576971 Mycobacterium phage Arlo, complete genome 28739-28765 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_028815 Mycobacterium phage Nhonho, complete genome 29082-29108 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732371-1732397 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 120441-120467 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 179896-179922 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 74237-74263 6 0.778
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 524877-524903 6 0.778
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466597-3466630 6 0.824
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210883-2210916 6 0.824
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283764-283797 6 0.824
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445248-445281 6 0.824
NZ_CP014566_12 12.2|4064447|36|NZ_CP014566|CRISPRCasFinder 4064447-4064482 36 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1551727-1551762 6 0.833
NZ_CP014566_12 12.2|4064447|36|NZ_CP014566|CRISPRCasFinder 4064447-4064482 36 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1173509-1173544 6 0.833
NZ_CP014566_1 1.3|332146|30|NZ_CP014566|CRT 332146-332175 30 MK460246 Mycobacterium phage Nibb, complete genome 5349-5378 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 401811-401840 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 191003-191032 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 130127-130156 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 282765-282794 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1675975-1676004 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 988804-988833 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 1096-1125 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 98302-98331 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 258318-258347 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 52934-52963 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 944807-944836 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1187570-1187599 7 0.767
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 36879-36908 7 0.767
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1328751-1328780 7 0.767
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 803623-803652 7 0.767
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 47988-48017 7 0.767
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 273279-273308 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3050899-3050925 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350099-350125 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350108-350134 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24366 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK524490 Mycobacterium phage Donny, complete genome 33811-33837 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT522000 Mycobacterium phage Soul22, complete genome 22192-22218 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22216 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 AY129336 Mycobacteriophage Che9d, complete genome 22205-22231 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK967392 Gordonia phage GrandSlam, complete genome 24586-24612 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23681 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22219 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22891 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MH669001 Mycobacterium phage EleanorGeorge, complete genome 25342-25368 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22584 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22811 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_023698 Mycobacterium phage Avani, complete genome 22197-22223 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 JN699007 Mycobacterium phage Acadian, complete genome 33806-33832 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33837 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 MH077585 Mycobacterium phage TChen, complete genome 22970-22996 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22809 7 0.741
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 KC736071 Mycobacterium phage WIVsmall, complete genome 29690-29716 7 0.741
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210628-2210661 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209827-2209860 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 24930-24963 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133215-2133248 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT889380 Mycobacterium phage Coco12, complete genome 22836-22869 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22524 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 531146-531179 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 117310-117343 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254574-254607 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP039641 Azospirillum sp. TSH100 plasmid p2, complete sequence 30914-30947 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH697583 Mycobacterium phage EricMillard, complete genome 32257-32290 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH727551 Mycobacterium phage Kalah2, complete genome 32307-32340 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH077579 Mycobacterium phage Halley, complete genome 31970-32003 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH669017 Mycobacterium phage Zelink, complete genome 33051-33084 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN062701 Mycobacterium phage Dallas, complete genome 31496-31529 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 32107-32140 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK524529 Mycobacterium phage Phoebus, complete genome 32257-32290 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MF919512 Mycobacterium phage Klein, complete genome 31531-31564 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KF114875 Mycobacterium phage Redno2, complete genome 31720-31753 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK967379 Mycobacterium phage HokkenD, complete genome 31519-31552 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 307986-308019 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178492-178525 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275379-275412 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445383-445416 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275378-275411 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN813686 Mycobacterium phage BirdsNest, complete genome 30327-30360 7 0.794
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 31516-31549 7 0.794
NZ_CP014566_5 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder 1215053-1215089 37 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136926 7 0.811
NZ_CP014566_7 7.3|2071353|30|NZ_CP014566|CRT 2071353-2071382 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NZ_CP014566_7 7.3|2071353|30|NZ_CP014566|CRT 2071353-2071382 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NZ_CP014566_7 7.3|2071353|30|NZ_CP014566|CRT 2071353-2071382 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NZ_CP014566_12 12.2|4064447|36|NZ_CP014566|CRISPRCasFinder 4064447-4064482 36 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1479789-1479824 7 0.806
NZ_CP014566_1 1.3|332146|30|NZ_CP014566|CRT 332146-332175 30 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 475069-475098 8 0.733
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_019847 Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence 101111-101140 8 0.733
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 730591-730620 8 0.733
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 480868-480897 8 0.733
NZ_CP014566_1 1.12|332626|30|NZ_CP014566|CRT 332626-332655 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 61392-61421 8 0.733
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1255759-1255788 8 0.733
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 53329-53358 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466471-3466504 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350662-350695 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350530-350563 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3051061-3051094 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36586-36619 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28566-28599 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117037-117070 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928385-928418 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 131278-131311 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117079-117112 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117037-117070 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 670302-670335 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1123064-1123097 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530145-530178 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187401-187434 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN234223 Mycobacterium phage Philly, complete genome 30948-30981 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KJ194581 Mycobacterium phage Audrey, complete genome 31094-31127 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH051265 Mycobacterium phage Yahalom, complete genome 31107-31140 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH316565 Mycobacterium phage Mortcellus, complete genome 31732-31765 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT310871 Mycobacterium phage Jackstina, complete genome 31017-31050 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 EU816589 Mycobacterium phage Phaedrus, complete genome 31013-31046 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT952851 Mycobacterium phage Gervas, complete genome 31075-31108 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MG920059 Mycobacterium phage Baloo, complete genome 31097-31130 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_023686 Mycobacterium phage Gadjet, complete genome 31104-31137 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_041965 Mycobacterium phage Athena, complete genome 31845-31878 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 DQ398049 Mycobacterium phage Pipefish, complete genome 32489-32522 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT310892 Mycobacterium phage Compostia, complete genome 31524-31557 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN699018 Mycobacterium phage Kamiyu, complete genome 31063-31096 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687345-687378 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 118498-118531 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 539300-539333 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK814754 Mycobacterium phage Sumter, complete genome 28141-28174 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK814754 Mycobacterium phage Sumter, complete genome 28639-28672 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22621 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24847 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT522000 Mycobacterium phage Soul22, complete genome 22192-22225 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25573 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24995 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22223 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 AY129336 Mycobacteriophage Che9d, complete genome 22205-22238 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28509 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23688 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22226 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22898 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22591 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24995 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24862 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22818 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN698995 Mycobacterium phage Dori, complete genome 28163-28196 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_023698 Mycobacterium phage Avani, complete genome 22197-22230 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24670 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19984-20017 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH077585 Mycobacterium phage TChen, complete genome 22970-23003 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22816 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125963-125996 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 138036-138069 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN096355 Mycobacterium phage Purky, complete genome 13505-13538 8 0.765
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN234183 Mycobacterium phage Antsirabe, complete genome 23060-23093 8 0.765
NZ_CP014566_5 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder 1215053-1215089 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683728-683764 8 0.784
NZ_CP014566_7 7.3|2071353|30|NZ_CP014566|CRT 2071353-2071382 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NZ_CP014566_7 7.3|2071353|30|NZ_CP014566|CRT 2071353-2071382 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NZ_CP014566_10 10.30|3068786|29|NZ_CP014566|PILER-CR 3068786-3068814 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NZ_CP014566_13 13.1|4064802|29|NZ_CP014566|CRISPRCasFinder 4064802-4064830 29 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 33070-33098 8 0.724
NZ_CP014566_1 1.13|332674|39|NZ_CP014566|CRT 332674-332712 39 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 24079-24117 9 0.769
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NZ_CP014566_2 2.1|693294|31|NZ_CP014566|CRISPRCasFinder 693294-693324 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NZ_CP014566_3 3.8|929140|30|NZ_CP014566|CRT 929140-929169 30 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 272281-272310 9 0.7
NZ_CP014566_3 3.15|929440|30|NZ_CP014566|CRT 929440-929469 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NZ_CP014566_3 3.17|929536|30|NZ_CP014566|CRT 929536-929565 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NZ_CP014566_3 3.19|929626|27|NZ_CP014566|CRT 929626-929652 27 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 195315-195341 9 0.667
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350134 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210928-2210961 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 231456-231489 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306612-306645 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283233-283266 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 EF602154 Burkholderia phage BcepNY3, complete genome 21505-21538 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23287-23320 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_005263 Burkholderia phage Bcep1, complete genome 23287-23320 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 307143-307176 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 298112-298145 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 723127-723160 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 19270-19303 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15929-15962 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 652970-653003 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 490801-490834 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 637964-637997 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235008-235041 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646029-646062 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 635838-635871 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684904-684937 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303766-1303799 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897262-897295 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233325-233358 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560015-560048 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424629-1424662 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796570-796603 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659643-659676 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083784-1083817 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052610-1052643 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1150006-1150039 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654523-654556 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771404-771437 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290861-290894 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371773-371806 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224363-1224396 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 997046-997079 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083789-1083822 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH001451 Mycobacterium phage Nairb, complete genome 21242-21275 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21275 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH588544 Caulobacter phage CcrBL10, complete genome 39042-39075 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21275 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21275 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21275 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN735432 Mycobacteriophage Whitty, complete genome 21242-21275 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 82507-82540 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 82532-82565 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 82528-82561 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 90688-90721 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 82645-82678 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55533-55566 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318448-318481 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 81659-81692 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 84861-84894 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 135548-135581 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498515-498548 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 927230-927263 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 241368-241401 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455289-455322 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 241368-241401 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 239809-239842 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 244056-244089 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 238174-238207 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 131481-131514 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 241368-241401 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 747004-747037 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KC736071 Mycobacterium phage WIVsmall, complete genome 29683-29716 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 171949-171982 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52128 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 129601-129634 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 301604-301637 9 0.735
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 779027-779060 9 0.735
NZ_CP014566_5 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder 1215053-1215089 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 686592-686628 9 0.757
NZ_CP014566_9 9.9|3066034|37|NZ_CP014566|CRISPRCasFinder,CRT 3066034-3066070 37 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 74714-74750 9 0.757
NZ_CP014566_9 9.10|3066107|37|NZ_CP014566|CRISPRCasFinder,CRT 3066107-3066143 37 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 74714-74750 9 0.757
NZ_CP014566_10 10.17|3069371|39|NZ_CP014566|CRISPRCasFinder,CRT 3069371-3069409 39 NZ_CP014277 Martelella sp. AD-3 plasmid unnamed2, complete sequence 91271-91309 9 0.769
NZ_CP014566_10 10.38|3069375|39|NZ_CP014566|PILER-CR 3069375-3069413 39 NZ_CP014277 Martelella sp. AD-3 plasmid unnamed2, complete sequence 91271-91309 9 0.769
NZ_CP014566_3 3.2|928852|39|NZ_CP014566|CRT 928852-928890 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210946-2210979 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732364-1732397 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 21676-21709 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 96060-96093 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 93944-93977 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98684-98717 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK524490 Mycobacterium phage Donny, complete genome 33811-33844 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MK494095 Mycobacterium phage Daegal, complete genome 5959-5992 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN699007 Mycobacterium phage Acadian, complete genome 33806-33839 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33844 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 47518-47551 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27460-27493 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 194712-194745 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 362178-362211 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 10252-10285 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677361-677394 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 8446-8479 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65893-65926 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 640930-640963 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104485-104518 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 31366-31399 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 29995-30028 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 16577-16610 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100724-100757 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31148-31181 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12357-12390 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25168-25201 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 17683-17716 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1350942-1350975 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 136497-136530 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 46815-46848 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 25131-25164 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16215-16248 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 15931-15964 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 15932-15965 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 15939-15972 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 15929-15962 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16066-16099 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_001381 Mycobacterium fortuitum plasmid pAL5000, complete sequence 2682-2715 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31441-31474 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 40579-40612 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 15940-15973 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50284-50317 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17431-17464 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 15928-15961 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 15930-15963 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155712-155745 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 16433-16466 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10533-10566 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49358-49391 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 23524-23557 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 71777-71810 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 15940-15973 10 0.706
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MN234219 Mycobacterium phage Mercurio, complete genome 23308-23341 10 0.706
NZ_CP014566_5 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder 1215053-1215089 37 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 331923-331959 10 0.73
NZ_CP014566_5 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder 1215053-1215089 37 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 716620-716656 10 0.73
NZ_CP014566_9 9.1|3065442|35|NZ_CP014566|PILER-CR,CRISPRCasFinder,CRT 3065442-3065476 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350092-350125 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 239254-239287 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MH051334 Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome 23136-23169 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 MG852086 Escherichia phage vB_EcoS-Ro145clw, complete genome 41310-41343 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261086-261119 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 584732-584765 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 70292-70325 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507461-507494 11 0.676
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 155836-155869 11 0.676
NZ_CP014566_5 5.5|1214837|40|NZ_CP014566|CRISPRCasFinder 1214837-1214876 40 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261884-261923 11 0.725
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190139-190172 12 0.647
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 14966-14999 12 0.647
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302491-302524 14 0.588
NZ_CP014566_5 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder 1214732-1214765 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282346-282379 15 0.559

1. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtgcc	Protospacer
********************.*

2. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcgaagccggcggcagcg	Protospacer
*******.**************

3. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

4. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

5. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

6. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

7. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

8. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

9. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

10. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcgcagccggcggcagcg	Protospacer
******* **************

11. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

12. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

13. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

14. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

15. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

16. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

17. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

18. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

19. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

20. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

21. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

22. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

23. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KP087941 (Eel River basin pequenovirus isolate c10494, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagccggcggctgcg	Protospacer
****************** ***

24. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

25. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

26. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

27. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

28. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

29. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

30. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

31. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

32. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

33. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

34. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

35. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

36. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

37. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

38. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

39. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

40. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

41. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

42. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

43. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

44. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

45. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

46. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

47. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

48. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

49. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

50. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

51. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

52. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

53. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 1, identity: 0.955

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggcgccggcggcagcg	Protospacer
******** *************

54. spacer 3.19|929626|27|NZ_CP014566|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcgg	Protospacer
** ******** ***************

55. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcgg	Protospacer
** ******** ***************

56. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 2, identity: 0.926

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcgg	Protospacer
** ******** ***************

57. spacer 4.1|930632|23|NZ_CP014566|PILER-CR matches to NZ_CP049042 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_5, complete sequence) position: , mismatch: 2, identity: 0.913

ccccggtggcggcaccaccagcc	CRISPR spacer
ccccggtggcgtcaccaccagca	Protospacer
*********** ********** 

58. spacer 4.1|930632|23|NZ_CP014566|PILER-CR matches to NZ_CP045388 (Ruegeria sp. THAF33 plasmid pTHAF33_d, complete sequence) position: , mismatch: 2, identity: 0.913

ccccggtggcggcaccaccagcc	CRISPR spacer
ccccggtggcgtcaccaccagca	Protospacer
*********** ********** 

59. spacer 4.1|930632|23|NZ_CP014566|PILER-CR matches to NZ_CP020932 (Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence) position: , mismatch: 2, identity: 0.913

ccccggtggcggcaccaccagcc	CRISPR spacer
ccacggtggcggcaccgccagcc	Protospacer
** *************.******

60. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtggg	Protospacer
********************  

61. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
agtcggcggtgccgacggtgtc	Protospacer
 *************.*******

62. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggcgtc	Protospacer
.*****************.***

63. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
.**********.**********

64. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggcggcgtc	Protospacer
 *****************.***

65. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

66. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

67. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggccgtgtc	Protospacer
 *************** *****

68. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgacggcggtgccggcggtgtg	Protospacer
** ****************** 

69. spacer 5.15|1215353|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909

ggacggtggtaccggcggtcag	CRISPR spacer
tgacggtggtgccggcggtcag	Protospacer
 *********.***********

70. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

71. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

72. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

73. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

74. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

75. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

76. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggagccggcggcatcg	Protospacer
.****************** **

77. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggagccggcggcggcg	Protospacer
.*****************.***

78. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagccggcggcggct	Protospacer
******************.** 

79. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagacggcggcagcc	Protospacer
********** ********** 

80. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggagccggcggcatcg	Protospacer
.****************** **

81. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggagccggcggcatcg	Protospacer
.****************** **

82. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagacggcggcagcc	Protospacer
********** ********** 

83. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
gccggcggagacggcggcagcc	Protospacer
********** ********** 

84. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

85. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 2, identity: 0.909

gccggcggagccggcggcagcg	CRISPR spacer
accggcggcgccggcggcagcg	Protospacer
.******* *************

86. spacer 1.11|332581|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
tcgccgttggcgatcagtccgccgtcg	Protospacer
.************ ***********.*

87. spacer 1.11|332581|27|NZ_CP014566|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
tcgccgttggcgatcagtccgccgtcg	Protospacer
.************ ***********.*

88. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

89. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

90. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

91. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

92. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

93. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

94. spacer 3.18|929584|24|NZ_CP014566|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

95. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

96. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

97. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

98. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

99. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

100. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

101. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

102. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

103. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

104. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 3, identity: 0.889

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgg	Protospacer
  **************** ********

105. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 3, identity: 0.889

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcta	Protospacer
******************.****** .

106. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MN549360 (Rhizobium phage RL38J1, complete genome) position: , mismatch: 3, identity: 0.889

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgctgg-cggcaaaggcggtaacggcgg	Protospacer
 ****. ****** **************

107. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

108. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

109. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

110. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

111. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

112. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

113. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtggt	Protospacer
.******************* .

114. spacer 5.7|1214969|22|NZ_CP014566|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
catcggcggtgccggcggtgtg	Protospacer
..******************* 

115. spacer 5.11|1215152|22|NZ_CP014566|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

gctgtggggcggcggtggtgcc	CRISPR spacer
cgtgtggggcggcggtggtgca	Protospacer
  ******************* 

116. spacer 7.5|2071443|24|NZ_CP014566|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

117. spacer 7.5|2071443|24|NZ_CP014566|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

118. spacer 12.1|4064400|22|NZ_CP014566|CRISPRCasFinder matches to MN857473 (Teseptimavirus S2B, complete genome) position: , mismatch: 3, identity: 0.864

gccggcggagccggcggcagcg	CRISPR spacer
cgaggcggagccggcggcagcg	Protospacer
   *******************

119. spacer 3.12|929299|27|NZ_CP014566|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

120. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

121. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

122. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

123. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

124. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

125. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

126. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

127. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

128. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

129. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

130. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

131. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

132. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

133. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

134. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

135. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

136. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

137. spacer 3.18|929584|24|NZ_CP014566|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

138. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgg	Protospacer
  * .**********************

139. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MG198783 (Gordonia phage Mahdia, complete genome) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ccagaccggcaacggcggtaacggcgt	Protospacer
 * **.******************** 

140. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 4, identity: 0.852

--gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggccgg--ggcaacggcggtaacggcgg	Protospacer
  **.*.  ********************

141. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ggtgatcgtcaacggcggcaacggcga	Protospacer
* ****** *********.*******.

142. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgctcggccacggcggtaacggctg	Protospacer
 *** ***** ************** *

143. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggtgacgacag	Protospacer
 ******************.***.*.*

144. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggtgacgacag	Protospacer
 ******************.***.*.*

145. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.852

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcgggaacaaccg	Protospacer
****************** ***..* *

146. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

--gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tagcgg--cggcaacggcggtagcggcgg	Protospacer
  ** *  **************.******

147. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.852

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg	Protospacer
 **.*. ************.********

148. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.852

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg	Protospacer
 **.*. ************.********

149. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

150. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

151. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

152. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gtccggcggccttggcgtagcgcct	Protospacer
  **********.***********.

153. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

154. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggccccggcgtcgcgcga	Protospacer
***********.****** ****  

155. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtaatggtc	Protospacer
*******************..* .*

156. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcatcggcgtagcggcg	Protospacer
.********* *********** * 

157. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcctccgcgtcgcgcct	Protospacer
.************ **** *****.

158. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcgggc	Protospacer
.*.*******************  *

159. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggccgcgtcgtagcgcca	Protospacer
.********** ** ********* 

160. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

161. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggtgtcctcggcgtagcgcga	Protospacer
******.* **************  

162. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

163. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggctgcctcggcatagcgccg	Protospacer
 ****** ********.******* 

164. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

165. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggtggcctcggcgtagccccg	Protospacer
.*****.************** ** 

166. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

167. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tggcggcggcctcgccgtagcgctt	Protospacer
** *********** ********..

168. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcggac	Protospacer
.*.*******************  *

169. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
agccggcggcctcggcctcgcgccg	Protospacer
 *************** * ***** 

170. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

171. spacer 7.5|2071443|24|NZ_CP014566|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

172. spacer 7.5|2071443|24|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

173. spacer 7.5|2071443|24|NZ_CP014566|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

174. spacer 1.2|332101|27|NZ_CP014566|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815

ccggcgcctagagcgttggcaccgctg	CRISPR spacer
ctcgggcctagagcgttggcaccgtgg	Protospacer
*. * *******************. *

175. spacer 1.11|332581|27|NZ_CP014566|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
ccgccgttggcgaccagtccgcaatca	Protospacer
************* ******** .*..

176. spacer 1.11|332581|27|NZ_CP014566|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
gggtcgtcggagaacagtccgccgttg	Protospacer
  *.***.** ****************

177. spacer 1.11|332581|27|NZ_CP014566|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815

ccgccgttggcgaacagtccgccgttg	CRISPR spacer
gtggcgttgtcgaacagaccgccgttg	Protospacer
 .* ***** ******* *********

178. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccgggtcaccgccagcggggccagga	Protospacer
********* ************ ***. *.

179. spacer 1.12|332626|30|NZ_CP014566|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccgatccagacaccgccagcggcgccgagg	Protospacer
***..* .******************* **

180. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ccggccgggacaccgccagcggcg-ccgtgg	CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg-	Protospacer
*****************  *****  **.* 

181. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

182. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

183. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc	Protospacer
  *.****  **** **************** 

184. spacer 3.5|929005|27|NZ_CP014566|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

185. spacer 3.5|929005|27|NZ_CP014566|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

186. spacer 3.5|929005|27|NZ_CP014566|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

187. spacer 3.5|929005|27|NZ_CP014566|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

188. spacer 3.5|929005|27|NZ_CP014566|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgg	Protospacer
    ****************.******

189. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.833

cggattcggcggattccgcggcggggaggg	CRISPR spacer
cggattcgcccgattccgcggcggcccggg	Protospacer
******** * *************   ***

190. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833

cggattcggcggattccgcggcggggaggg	CRISPR spacer
cggattcgcccgattccgcggcggcacggg	Protospacer
******** * ************* . ***

191. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

192. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

193. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

194. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

195. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

196. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

197. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

198. spacer 3.12|929299|27|NZ_CP014566|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

199. spacer 3.12|929299|27|NZ_CP014566|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

200. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

201. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

202. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

203. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

204. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

205. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

206. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

207. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

208. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

209. spacer 3.17|929536|30|NZ_CP014566|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

210. spacer 3.18|929584|24|NZ_CP014566|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

211. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggtaacgccgg	Protospacer
 .*.*. ***************** ***

212. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gttcttcggcaacggcggcaacggcgc	Protospacer
*.*  *************.******* 

213. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

214. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggcgacaacggttt	Protospacer
*****************..*****.  

215. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

216. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

217. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tctgatcggcaacggcggcaacgacac	Protospacer
 *****************.****.*. 

218. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

219. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

220. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggctgtgacgccac	Protospacer
**************** **.*** *. 

221. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacgatag	Protospacer
**** *************.****...*

222. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacgatag	Protospacer
**** *************.****...*

223. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.815

gctgat--cggcaacggcggtaacggcgg	CRISPR spacer
--cgacggcggcaatggcggtaacggcgg	Protospacer
  .**.  ******.**************

224. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgaacggcaacggcggcaacgacac	Protospacer
***** ************.****.*. 

225. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

226. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

227. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

228. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

229. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

230. spacer 3.19|929626|27|NZ_CP014566|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

231. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

232. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

233. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

234. spacer 3.19|929626|27|NZ_CP014566|CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcatcggcggttacgacaa	Protospacer
*********** ******* ***.*..

235. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

236. spacer 3.19|929626|27|NZ_CP014566|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

237. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

238. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

239. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
taccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

240. spacer 3.19|929626|27|NZ_CP014566|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

241. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 5, identity: 0.815

-gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccgg-cggcaacggcggcaacggcgg	Protospacer
 .*.*. ************.********

242. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

243. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggtggcaacgactt	Protospacer
***************.**.****.*  

244. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

245. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

246. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

247. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggccacggcggcaacgacat	Protospacer
********** *******.****.*. 

248. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

249. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

250. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

251. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

252. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

253. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

254. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

255. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

256. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

257. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

258. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacggctgtgacgccac	Protospacer
**************** **.*** *. 

259. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgttcggcaacggcggcaacgatag	Protospacer
**** *************.****...*

260. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

261. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tcggatcggcaaaggcggtcacggcga	Protospacer
 * ********* ****** ******.

262. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 5, identity: 0.815

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcatcggcggttacgacaa	Protospacer
*********** ******* ***.*..

263. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc	Protospacer
******************** ********  *. 

264. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gcgcggcggcctcggcgtagagccg	Protospacer
   ***************** *** 

265. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

266. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
caccggcggcctcggcgtagcttgc	Protospacer
..******************* . *

267. spacer 5.4|1214789|25|NZ_CP014566|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

268. spacer 1.3|332146|30|NZ_CP014566|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
tcagcggagccgaagatcacgccgccgagc	Protospacer
.*.************* ** *******  *

269. spacer 1.12|332626|30|NZ_CP014566|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg	Protospacer
*************** ** *****  *  *

270. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

ccggccgggacaccgccagcggcgccgtgg----	CRISPR spacer
ccagccgggagaccgccagcggc----tggctct	Protospacer
**.******* ************    ***    

271. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8

--ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc	Protospacer
   .****  ******.************** 

272. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

273. spacer 3.5|929005|27|NZ_CP014566|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
gatggccggtaggctgttgaacggcgc	Protospacer
.. *******.******* ******* 

274. spacer 3.5|929005|27|NZ_CP014566|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

275. spacer 3.5|929005|27|NZ_CP014566|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

276. spacer 3.5|929005|27|NZ_CP014566|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

277. spacer 3.5|929005|27|NZ_CP014566|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

278. spacer 3.5|929005|27|NZ_CP014566|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

279. spacer 3.5|929005|27|NZ_CP014566|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

280. spacer 3.5|929005|27|NZ_CP014566|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778

aggggccggtgggctgttcaacggcgg	CRISPR spacer
ccttggcggtgggctgttcagcggcgg	Protospacer
    * **************.******

281. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

282. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

283. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

284. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

285. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

286. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

287. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

288. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

289. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgatgg	Protospacer
   .******************** ** **

290. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

291. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

292. spacer 3.8|929140|30|NZ_CP014566|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

293. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

294. spacer 3.8|929140|30|NZ_CP014566|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gctgttcggcggattccgcggcggcgacgg	Protospacer
   .******************** ** **

295. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcggggtccg	Protospacer
 ************  ***********   *

296. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcggggtccg	Protospacer
 ************  ***********   *

297. spacer 3.12|929299|27|NZ_CP014566|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

298. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

299. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

300. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

301. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

302. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

303. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

304. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

305. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

306. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

307. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

308. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

309. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

310. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

311. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

312. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

313. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

314. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

315. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

316. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

317. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

318. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

319. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

320. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

321. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

322. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

323. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

324. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

325. spacer 3.17|929536|30|NZ_CP014566|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

326. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

327. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

328. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

329. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

330. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

331. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

332. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

333. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

334. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

335. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

336. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

337. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

338. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

339. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

340. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

341. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

342. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

343. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

344. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

345. spacer 3.17|929536|30|NZ_CP014566|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

346. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
aacgggcggcaacggcggcaacggcgg	Protospacer
. .*. ************.********

347. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ccccggcggcaacggcggcaacggcgg	Protospacer
 *. . ************.********

348. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
acgcggcggcgacggcggtaacggcgg	Protospacer
.*  . ****.****************

349. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
tgaaagcggcaacggcggtaacggcga	Protospacer
   .* ********************.

350. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ccacgctggcaacggcggtaacggcgg	Protospacer
 *  ...********************

351. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcgg	Protospacer
* . . ************ ********

352. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacgccggcaacgatac	Protospacer
************** ***.****... 

353. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gagcggcggcaacggcggcaacggcgg	Protospacer
*   . ************.********

354. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ggccggcggcagcggcggtaacggcgg	Protospacer
* . . *****.***************

355. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ggacgccggcaacggcggcaacggcgg	Protospacer
*   ..************.********

356. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caccatcggcaacggcggtagcggtgg	Protospacer
  . ****************.***.**

357. spacer 3.19|929626|27|NZ_CP014566|CRT matches to KR997929 (Mycobacterium phage Barriga, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatgggcaacggcggcaacggcgg	Protospacer
    ** ***********.********

358. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatgggcaacggcggcaacggcgg	Protospacer
    ** ***********.********

359. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_028815 (Mycobacterium phage Nhonho, complete genome) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatgggcaacggcggcaacggcgg	Protospacer
    ** ***********.********

360. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gagcggcggcaacggcggtaccggcgg	Protospacer
*   . ************** ******

361. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
actgagcggcaacggcggaaacggaat	Protospacer
.**** ************ ***** . 

362. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cggcatcggcaacggcggttgcggcgg	Protospacer
    *************** .******

363. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
gctgatcggcaacgccggcaacgatac	Protospacer
************** ***.****... 

364. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.778

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
actgagcggcaacggcggaaacggaat	Protospacer
.**** ************ ***** . 

365. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc--	Protospacer
************ ******* *****  * .***  

366. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc--	Protospacer
 .****************** ****** *  ***  

367. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct-	Protospacer
 .*********.*************** ..**** 

368. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac	Protospacer
 * ******************.**. ****** * 

369. spacer 12.2|4064447|36|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.833

cgggaacggcggggccggcgggctgctgttcggtac	CRISPR spacer
cggcaacggcggggccggcgggccgctgaccgcgac	Protospacer
*** *******************.**** .**  **

370. spacer 12.2|4064447|36|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.833

cgggaacggcggggccggcgggctgctgttcggtac	CRISPR spacer
cggcaacggcggggccggcgggccgctgaccgcgac	Protospacer
*** *******************.**** .**  **

371. spacer 1.3|332146|30|NZ_CP014566|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc	Protospacer
******.******** ********  .. *

372. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca	Protospacer
******.******** ********* .  .

373. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca	Protospacer
..**** ** *****************. .

374. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc	Protospacer
* ******.***************. . * 

375. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc	Protospacer
.** *.. *** ***************** 

376. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacaccga	Protospacer
******.*************.**.*  .*.

377. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

378. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

379. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

380. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg	Protospacer
 ******** **.***********   .**

381. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
accgcatcgaccccgccagcggcgccgtga	Protospacer
 * **   *** *****************.

382. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

383. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccgccagcagcacgccga	Protospacer
******.*************.**.*  .*.

384. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccatccggcacaccgccagcggcaccggca	Protospacer
**. **** **************.***  .

385. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

386. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

387. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

388. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

389. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

390. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

391. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

392. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

393. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

394. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

395. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

396. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

397. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

398. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

399. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

400. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

401. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcgggatccg	Protospacer
 ************  **********.   *

402. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
aggattcggcggaggccgcggcgggatccg	Protospacer
 ************  **********.   *

403. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
cccgctgggcggattccgcgtcggggaagg	Protospacer
*  ..* ************* ******.**

404. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.767

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gggattcggtggattcagcggcggtggtgc	Protospacer
 ********.****** ******* *. * 

405. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

406. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

407. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

408. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

409. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

410. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

411. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

412. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

413. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

414. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

415. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

416. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

417. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

418. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

419. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

420. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

421. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

422. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

423. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

424. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

425. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

426. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

427. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

428. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

429. spacer 3.15|929440|30|NZ_CP014566|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

430. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

431. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

432. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

433. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

434. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

435. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

436. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

437. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

438. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

439. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

440. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

441. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

442. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

443. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

444. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

445. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

446. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

447. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

448. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

449. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

450. spacer 3.15|929440|30|NZ_CP014566|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

451. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

452. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

453. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

454. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

455. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

456. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

457. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

458. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

459. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

460. spacer 3.15|929440|30|NZ_CP014566|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

461. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

462. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

463. spacer 3.15|929440|30|NZ_CP014566|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

464. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

465. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

466. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

467. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

468. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

469. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

470. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

471. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

472. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

473. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

474. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

475. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

476. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

477. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

478. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

479. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

480. spacer 3.15|929440|30|NZ_CP014566|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

481. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

482. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

483. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

484. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

485. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

486. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

487. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

488. spacer 3.15|929440|30|NZ_CP014566|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

489. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

490. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

491. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

492. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

493. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

494. spacer 3.15|929440|30|NZ_CP014566|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

495. spacer 3.15|929440|30|NZ_CP014566|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

496. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

497. spacer 3.15|929440|30|NZ_CP014566|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

498. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

499. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

500. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

501. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

502. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

503. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

504. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

505. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

506. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

507. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

508. spacer 3.17|929536|30|NZ_CP014566|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

509. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

510. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

511. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

512. spacer 3.17|929536|30|NZ_CP014566|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

513. spacer 3.17|929536|30|NZ_CP014566|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

514. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

515. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

516. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

517. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

518. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

519. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

520. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cgcaggcggcaacggcggtagcggcgg	Protospacer
  ... **************.******

521. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caacggcggcaacggcggcaacggcgg	Protospacer
    . ************.********

522. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caacggcggcaacggcggcaacggcgg	Protospacer
    . ************.********

523. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcgg	Protospacer
... .  ********************

524. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

525. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

526. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

527. spacer 3.19|929626|27|NZ_CP014566|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

528. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctcgatcagcaacggcggtaacggttt	Protospacer
 ..****.****************.  

529. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

530. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

531. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

532. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
cacccccggaaacggcggtaacggcgg	Protospacer
  .  .*** *****************

533. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

534. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

535. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ttccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

536. spacer 3.19|929626|27|NZ_CP014566|CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

537. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

538. spacer 3.19|929626|27|NZ_CP014566|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

539. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
ctccggcggcaacggcggcaacggcgg	Protospacer
 .. . ************.********

540. spacer 3.19|929626|27|NZ_CP014566|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 7, identity: 0.741

gctgatcggcaacggcggtaacggcgg	CRISPR spacer
caacggcggcaacggcggcaacggcgg	Protospacer
    . ************.********

541. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc-	Protospacer
****** **** *************** ..** . 

542. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc--	Protospacer
*.*********.********* *****.  .***  

543. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc-	Protospacer
 ** *************** ******* *. **. 

544. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta----	CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac	Protospacer
****** ************* ****    * ***    

545. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

546. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

547. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc--	Protospacer
 *.********.******** *******  .***  

548. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc--	Protospacer
*********** *****.******* * *  .**  

549. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat	Protospacer
 .******** ********.***** **.*** * 

550. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc-	Protospacer
.* ******** ******** ****** * ***. 

551. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

552. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

553. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

554. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

555. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

556. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

557. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

558. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

559. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

560. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

561. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct-	Protospacer
.* ***.****.*************** *  *** 

562. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg-tggcta	CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt-	Protospacer
**.***** ***************.*.. *** * 

563. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

564. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt	Protospacer
 * ***************** .*** ****** . 

565. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

566. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc--	Protospacer
 **.****************.****.  * ****  

567. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac	Protospacer
 * ***************** .*** *****..* 

568. spacer 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac	Protospacer
******************..*******  . ***.**

569. spacer 7.3|2071353|30|NZ_CP014566|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

570. spacer 7.3|2071353|30|NZ_CP014566|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

571. spacer 7.3|2071353|30|NZ_CP014566|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

572. spacer 12.2|4064447|36|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.806

cgggaacggcggggccggcgggctgctgttcggtac	CRISPR spacer
gggcaacggcggggccggcgggccgctgaccgccac	Protospacer
 ** *******************.**** .** .**

573. spacer 1.3|332146|30|NZ_CP014566|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733

ccggcggagccgaagagcaagccgccgttc	CRISPR spacer
agcacgaagccgaagagaaagccgccgatg	Protospacer
   .**.********** ********* * 

574. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcaccctggacaccgcctgcggcgccggac	Protospacer
.*. ** ********** ********* . 

575. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
ccggccaggacaccggcagcggcacgaaca	Protospacer
******.******** *******.* .  .

576. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcggcgccgtgg	CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga	Protospacer
.**     **************** ****.

577. spacer 1.12|332626|30|NZ_CP014566|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

ccggccgggacaccgccagcg----gcgccgtgg	CRISPR spacer
agggccgggacaccgcccgcggccagcgct----	Protospacer
  *************** ***    ****.    

578. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733

cggattcggcggattccgcggcggggaggg	CRISPR spacer
agttcgcggcggaatccgcggcggggaacg	Protospacer
 *  . ******* *************. *

579. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

cggattcggcggattccgcggcggggaggg	CRISPR spacer
gcccttcggcggatgccgcggcggcgagct	Protospacer
    ********** ********* ***  

580. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

581. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

582. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

583. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

584. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

585. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

586. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

587. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

588. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

589. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

590. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

591. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

592. spacer 3.15|929440|30|NZ_CP014566|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

593. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

594. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

595. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

596. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

597. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

598. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

599. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

600. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

601. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

602. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

603. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

604. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

605. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

606. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

607. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

608. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

609. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

610. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

611. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

612. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

613. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

614. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

615. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

616. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

617. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt--	Protospacer
 . ***************** ******  *.**.  

618. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc--	Protospacer
  *****************. ******  .** *  

619. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc--	Protospacer
 **********.** **********.*   .***  

620. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc	Protospacer
 *.******.**********.******  .**.*  

621. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

622. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc	Protospacer
 ****** ******.************ .**.  

623. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

624. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

625. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg	Protospacer
  ******* ** **************  * **.

626. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

627. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

628. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg	Protospacer
 ******** *****.***********   * *.

629. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc-	Protospacer
 .**********.** *********** .* **. 

630. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

631. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

632. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

633. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

634. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

635. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

636. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

637. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

638. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

639. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

640. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

641. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

642. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

643. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

644. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

645. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg----gtggcta	CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg----	Protospacer
 * ******** *******.*******    ***    

646. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc	Protospacer
*************** .********   * **..  

647. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcg-gcaacggcggcgccggcgggtggcta	CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc	Protospacer
  * .*** ** ******** ************. 

648. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

649. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

650. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

651. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

652. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

653. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

654. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

655. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

656. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

657. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

658. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

659. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

660. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

661. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

662. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

663. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

664. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

665. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg	Protospacer
 .***************** *.***** * * *.

666. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

667. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

668. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc--	Protospacer
 .*********.********* *****  ..***  

669. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

670. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

671. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat-	Protospacer
  .*******.********* ****** ** * * 

672. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca	Protospacer
.******************  **** * ..**.*

673. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat	Protospacer
*  ******** *******.***** **.**..* 

674. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca	Protospacer
 *.********.******** ******..* *.*

675. spacer 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc	Protospacer
 ********.* **************** . ***..*

676. spacer 7.3|2071353|30|NZ_CP014566|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

677. spacer 7.3|2071353|30|NZ_CP014566|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

678. spacer 10.30|3068786|29|NZ_CP014566|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

tccgcgaaattcactgcgcgttattcaag	CRISPR spacer
gacgcgaaatacactgcgctttattttca	Protospacer
  ******** ******** *****.  .

679. spacer 13.1|4064802|29|NZ_CP014566|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.724

aacggtggtaacgccggagttggcacgcc	CRISPR spacer
tccgctggtaacgccggagatggcattgt	Protospacer
  ** ************** *****.  .

680. spacer 1.13|332674|39|NZ_CP014566|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769

--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc	CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag	Protospacer
  ***. *.  **************** *** *******  

681. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

682. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

683. spacer 2.1|693294|31|NZ_CP014566|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

684. spacer 3.8|929140|30|NZ_CP014566|CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 9, identity: 0.7

cggattcggcggattccgcggcggggaggg	CRISPR spacer
tggatccggtggattccgcggcggccgcat	Protospacer
.****.***.**************  . . 

685. spacer 3.15|929440|30|NZ_CP014566|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

686. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

687. spacer 3.17|929536|30|NZ_CP014566|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

688. spacer 3.19|929626|27|NZ_CP014566|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.667

gctgatcggcaacggcggtaacggcgg---------	CRISPR spacer
---------caacggcggtaacggcggtaacggcgg	Protospacer
         ******************         

689. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc--	Protospacer
 . ****************. ******  ..***  

690. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc--	Protospacer
 . ****************  *****  *..***  

691. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc	Protospacer
 ************ ************  .. *  

692. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc--	Protospacer
 . ****.****.*************  * .***  

693. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc	Protospacer
 * ****** * ***************  *  * 

694. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

695. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

696. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

697. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

698. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

699. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa	Protospacer
 *.******* *********.****** ..*  *

700. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc	Protospacer
 .********* ******** ******* *  . 

701. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag	Protospacer
  ********** *************  *. * .

702. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

703. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat	Protospacer
*.********* *********** *** .. *  

704. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

705. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

706. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

707. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

708. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc	Protospacer
 * *********.******.*******   * * 

709. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

710. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

711. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga	Protospacer
  ****************** *.****  *   *

712. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

713. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

714. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

715. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

716. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

717. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

718. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

719. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

720. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

721. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

722. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

723. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

724. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

725. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

726. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

727. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

728. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg	Protospacer
*.****************** ***.** *  ...

729. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

730. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

731. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

732. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

733. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

734. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

735. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

736. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac	Protospacer
 *********  ************* .*. **  

737. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

738. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc--	Protospacer
   *******.********.******  **..**  

739. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt	Protospacer
* .*******.* **************  .**  

740. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

741. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg	Protospacer
 * ****************  ****** *   *.

742. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

743. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga	Protospacer
*  *******. ***************  .*  *

744. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

745. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

746. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc--	Protospacer
 .*****************.*** **  ...***  

747. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

748. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

749. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

750. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

751. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

752. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

753. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

754. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc--	Protospacer
 . ****************. *****  **..**  

755. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

756. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc	Protospacer
*. ****************. ****** *  *. 

757. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac	Protospacer
 * **** *********** *******  **   

758. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

759. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

760. spacer 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc	Protospacer
 ** **************** ******  *.* *  *

761. spacer 9.9|3066034|37|NZ_CP014566|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757

tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga	CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga	Protospacer
 **  . . ***.************* **********

762. spacer 9.10|3066107|37|NZ_CP014566|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757

tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga	CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga	Protospacer
 **  . . ***.************* **********

763. spacer 10.17|3069371|39|NZ_CP014566|CRISPRCasFinder,CRT matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769

tcaaaaacggggacggcatgctgcatgccctaacgtcgt----	CRISPR spacer
agaaaaacgaggacggcatgccgcatgcc----cgccgtccgc	Protospacer
  *******.***********.*******    **.***    

764. spacer 10.38|3069375|39|NZ_CP014566|PILER-CR matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769

tcaaaaacggggacggcatgctgcatgccctaacgtcgt----	CRISPR spacer
agaaaaacgaggacggcatgccgcatgcc----cgccgtccgc	Protospacer
  *******.***********.*******    **.***    

765. spacer 3.2|928852|39|NZ_CP014566|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

766. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcg-----ggtggcta	CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt-----	Protospacer
   *******.********** ****     ***     

767. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc	Protospacer
*. ***************..*******  .  * 

768. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc	Protospacer
. ********* ********* ***** . * . 

769. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg	Protospacer
 ********** ***** ******** *  ....

770. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc	Protospacer
  ********* *** ***********. *  . 

771. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact	Protospacer
. ********. ***************  *. . 

772. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

773. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga	Protospacer
 .********* *******.*******      *

774. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

775. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

776. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

777. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

778. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta-------	CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc	Protospacer
*****.****** *********       **.**       

779. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

780. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

781. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag	Protospacer
 * **********.*****.*******.  *  .

782. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

783. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

784. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

785. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

786. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

787. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

788. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

789. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

790. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

791. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc	Protospacer
 .*****..*****************  *  .* 

792. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

793. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

794. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

795. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

796. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

797. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

798. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

799. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

800. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

801. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

802. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

803. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

804. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

805. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

806. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

807. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

808. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

809. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

810. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

811. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg	Protospacer
*  ********.*********.*****  *  ..

812. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

813. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

814. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

815. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

816. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

817. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

818. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

819. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc	Protospacer
  ********.********* *****  . **  

820. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

821. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

822. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

823. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

824. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

825. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

826. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag	Protospacer
 * ** ***** ***************   *  .

827. spacer 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

828. spacer 5.9|1215053|37|NZ_CP014566|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

829. spacer 9.1|3065442|35|NZ_CP014566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

830. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg	Protospacer
 . ****************. ******   *...

831. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg	Protospacer
  .********.******** ******.   *..

832. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

833. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

834. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg	Protospacer
 .******** ******* ********  .  ..

835. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag	Protospacer
  .********* ********** ***  . * .

836. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg	Protospacer
 .  *************** *****.**  * ..

837. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg	Protospacer
 .. ******.*.***************  * ..

838. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc	Protospacer
*****.****** ***********  .    *. 

839. spacer 5.5|1214837|40|NZ_CP014566|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725

tgccggcggcgccggcggtgtcggcggacccgccgggttg	CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc	Protospacer
 *..******.***************** *** .*.  * 

840. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg	Protospacer
..********.****** ********   . ...

841. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgc-----cggcgggtggcta	CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg----	Protospacer
 ***** ..*. ***** ***     **** ****    

842. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga-----	Protospacer
     ***** ****. ***** . *** **.*      

843. spacer 5.3|1214732|34|NZ_CP014566|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga-----	Protospacer
     ***** ****. **.** . *** **.*      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage