Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013233 Collimonas arenae strain Ter10 chromosome, complete genome 4 crisprs WYL,DinG,cas3,csa3,DEDDh 9 14 1 0

Results visualization

1. NZ_CP013233
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013233_1 472917-472987 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013233_2 2233671-2235769 Orphan NA
27 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013233_3 2602184-2602290 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013233_4 2842515-2842630 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013233_2 2.2|2233808|34|NZ_CP013233|CRT 2233808-2233841 34 NZ_CP013233.1 2233637-2233670 2 0.941
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013233.1 3864148-3864181 2 0.941
NZ_CP013233_2 2.5|2234054|34|NZ_CP013233|CRT 2234054-2234087 34 NZ_CP013233.1 3864499-3864532 2 0.941
NZ_CP013233_2 2.5|2234054|34|NZ_CP013233|CRT 2234054-2234087 34 NZ_CP013233.1 3867787-3867820 2 0.941
NZ_CP013233_2 2.6|2234129|34|NZ_CP013233|CRT 2234129-2234162 34 NZ_CP013233.1 3864958-3864991 2 0.941
NZ_CP013233_2 2.6|2234129|34|NZ_CP013233|CRT 2234129-2234162 34 NZ_CP013233.1 3866506-3866539 2 0.941
NZ_CP013233_2 2.6|2234129|34|NZ_CP013233|CRT 2234129-2234162 34 NZ_CP013233.1 3868981-3869014 2 0.941
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP013233.1 4393393-4393426 2 0.941
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP013233.1 3864499-3864532 2 0.941
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP013233.1 2844785-2844818 2 0.941
NZ_CP013233_2 2.21|2235254|34|NZ_CP013233|CRT 2235254-2235287 34 NZ_CP013233.1 3864787-3864820 2 0.941
NZ_CP013233_2 2.24|2235479|34|NZ_CP013233|CRT 2235479-2235512 34 NZ_CP013233.1 3864499-3864532 2 0.941
NZ_CP013233_2 2.24|2235479|34|NZ_CP013233|CRT 2235479-2235512 34 NZ_CP013233.1 3867787-3867820 2 0.941
NZ_CP013233_2 2.24|2235479|34|NZ_CP013233|CRT 2235479-2235512 34 NZ_CP013233.1 3871012-3871045 2 0.941
NZ_CP013233_2 2.27|2235695|34|NZ_CP013233|CRT 2235695-2235728 34 NZ_CP013233.1 3864499-3864532 2 0.941
NZ_CP013233_2 2.27|2235695|34|NZ_CP013233|CRT 2235695-2235728 34 NZ_CP013233.1 3867787-3867820 2 0.941
NZ_CP013233_2 2.27|2235695|34|NZ_CP013233|CRT 2235695-2235728 34 NZ_CP013233.1 3871012-3871045 2 0.941

1. spacer 2.2|2233808|34|NZ_CP013233|CRT matches to position: 2233637-2233670, mismatch: 2, identity: 0.941

ctgtcgactggtctgagcacaaccaacagtaatg	CRISPR spacer
ctgtcgactggtttgagcaccaccaacagtaatg	Protospacer
************.******* *************

2. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to position: 3864148-3864181, mismatch: 2, identity: 0.941

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ttgtcgaccggtctgagcacaaccaacagcaacg	Protospacer
******** *********** *************

3. spacer 2.5|2234054|34|NZ_CP013233|CRT matches to position: 3864499-3864532, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaactaacagcaacg	CRISPR spacer
ctgtcgactggcttgagcacaaccaacagcaacg	Protospacer
***** *****************.**********

4. spacer 2.5|2234054|34|NZ_CP013233|CRT matches to position: 3867787-3867820, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaactaacagcaacg	CRISPR spacer
ctgtcaactggcttgagcacaaccaacagcaacg	Protospacer
***** *****************.**********

5. spacer 2.6|2234129|34|NZ_CP013233|CRT matches to position: 3864958-3864991, mismatch: 2, identity: 0.941

ctgtccacgggtctgagcaccactaacagcaacg	CRISPR spacer
ctgtccacgggtttgagcacgactaacagcaacg	Protospacer
************.******* *************

6. spacer 2.6|2234129|34|NZ_CP013233|CRT matches to position: 3866506-3866539, mismatch: 2, identity: 0.941

ctgtccacgggtctgagcaccactaacagcaacg	CRISPR spacer
ctgtccacgggtttgagcacgactaacagcaacg	Protospacer
************.******* *************

7. spacer 2.6|2234129|34|NZ_CP013233|CRT matches to position: 3868981-3869014, mismatch: 2, identity: 0.941

ctgtccacgggtctgagcaccactaacagcaacg	CRISPR spacer
ctgtccacgggtttgagcacgactaacagcaacg	Protospacer
************.******* *************

8. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to position: 4393393-4393426, mismatch: 2, identity: 0.941

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgtcgaccggcctgagcacgaccaacagcaacg	Protospacer
***** ************** *************

9. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to position: 3864499-3864532, mismatch: 2, identity: 0.941

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
ctgtcgactggcttgagcacaaccaacagcaacg	Protospacer
***********.******** *************

10. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to position: 2844785-2844818, mismatch: 2, identity: 0.941

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
ctctcgactggtttgagctccaccaacagcaacg	Protospacer
** *************** ***************

11. spacer 2.21|2235254|34|NZ_CP013233|CRT matches to position: 3864787-3864820, mismatch: 2, identity: 0.941

ctgtccactggcctgagcacaaccaacagtaacg	CRISPR spacer
ctgtcaactggcttgagcacaaccaacagtaacg	Protospacer
***** ******.*********************

12. spacer 2.24|2235479|34|NZ_CP013233|CRT matches to position: 3864499-3864532, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaaccaatagcaacg	CRISPR spacer
ctgtcgactggcttgagcacaaccaacagcaacg	Protospacer
***** ********************.*******

13. spacer 2.24|2235479|34|NZ_CP013233|CRT matches to position: 3867787-3867820, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaaccaatagcaacg	CRISPR spacer
ctgtcaactggcttgagcacaaccaacagcaacg	Protospacer
***** ********************.*******

14. spacer 2.24|2235479|34|NZ_CP013233|CRT matches to position: 3871012-3871045, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaaccaatagcaacg	CRISPR spacer
ctgtcgactggcctgagcacaaccaatagcaacg	Protospacer
***** ******.*********************

15. spacer 2.27|2235695|34|NZ_CP013233|CRT matches to position: 3864499-3864532, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaaccaatagcaacg	CRISPR spacer
ctgtcgactggcttgagcacaaccaacagcaacg	Protospacer
***** ********************.*******

16. spacer 2.27|2235695|34|NZ_CP013233|CRT matches to position: 3867787-3867820, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaaccaatagcaacg	CRISPR spacer
ctgtcaactggcttgagcacaaccaacagcaacg	Protospacer
***** ********************.*******

17. spacer 2.27|2235695|34|NZ_CP013233|CRT matches to position: 3871012-3871045, mismatch: 2, identity: 0.941

ctgtccactggcttgagcacaaccaatagcaacg	CRISPR spacer
ctgtcgactggcctgagcacaaccaatagcaacg	Protospacer
***** ******.*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013233_2 2.26|2235620|34|NZ_CP013233|CRT 2235620-2235653 34 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 15345-15378 1 0.971
NZ_CP013233_2 2.14|2234729|34|NZ_CP013233|CRT 2234729-2234762 34 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 15345-15378 2 0.941
NZ_CP013233_2 2.15|2234804|34|NZ_CP013233|CRT 2234804-2234837 34 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75919-75952 2 0.941
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75919-75952 2 0.941
NZ_CP013233_2 2.5|2234054|34|NZ_CP013233|CRT 2234054-2234087 34 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 15345-15378 3 0.912
NZ_CP013233_2 2.15|2234804|34|NZ_CP013233|CRT 2234804-2234837 34 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 15345-15378 3 0.912
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 14106-14130 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP023451 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence 150500-150524 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 153209-153233 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 89414-89438 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 CP021182 Sphingomonas wittichii DC-6 plasmid pDC01, complete sequence 65964-65988 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP041018 Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence 178468-178492 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_AP018666 Sphingobium amiense strain DSM 16289 plasmid pSAMIE_3, complete sequence 104656-104680 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NC_015595 Sphingobium chlorophenolicum L-1 plasmid pSPHCH01, complete sequence 98685-98709 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 141405-141429 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 202672-202696 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 647017-647041 3 0.88
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 411146-411170 3 0.88
NZ_CP013233_1 1.1|472940|25|NZ_CP013233|CRISPRCasFinder 472940-472964 25 MN693134 Marine virus AFVG_25M117, complete genome 17534-17558 4 0.84
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 114402-114435 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 114519-114552 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 114678-114711 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 114795-114828 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 114912-114945 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115029-115062 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115146-115179 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115263-115296 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115380-115413 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115497-115530 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115614-115647 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115731-115764 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 115806-115839 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116082-116115 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116358-116391 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116475-116508 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116592-116625 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116709-116742 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116826-116859 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 116943-116976 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117060-117093 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117219-117252 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117336-117369 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117453-117486 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117612-117645 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117729-117762 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117846-117879 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 117963-117996 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 118572-118605 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 118689-118722 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 118848-118881 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 118965-118998 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 119082-119115 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 119199-119232 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 5524-5557 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 5641-5674 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 5800-5833 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 5917-5950 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6034-6067 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6151-6184 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6268-6301 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6385-6418 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6502-6535 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6619-6652 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6736-6769 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6853-6886 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 6928-6961 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 7204-7237 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 7480-7513 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 7597-7630 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 7714-7747 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 7831-7864 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 7948-7981 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8065-8098 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8182-8215 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8341-8374 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8458-8491 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8575-8608 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8734-8767 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8851-8884 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 8968-9001 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 9085-9118 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 9694-9727 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 9811-9844 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 9970-10003 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 10087-10120 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 10204-10237 4 0.882
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 10321-10354 4 0.882
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NC_002682 Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence 34980-35004 4 0.84
NZ_CP013233_2 2.25|2235554|25|NZ_CP013233|CRT 2235554-2235578 25 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 43723-43747 4 0.84
NZ_CP013233_1 1.1|472940|25|NZ_CP013233|CRISPRCasFinder 472940-472964 25 NZ_CP029793 Psychrobacter sp. YP14 plasmid pYP14d, complete sequence 673-697 5 0.8
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 97237-97270 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 97345-97378 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 97453-97486 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 97561-97594 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 97885-97918 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 97993-98026 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 98101-98134 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 98209-98242 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP052134 Burkholderia glumae strain HN plasmid pbghn2, complete sequence 98749-98782 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 70634-70667 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 71174-71207 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 71714-71747 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 72146-72179 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 72254-72287 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 72578-72611 7 0.794
NZ_CP013233_2 2.4|2233979|34|NZ_CP013233|CRT 2233979-2234012 34 NZ_CP045089 Burkholderia glumae strain GX plasmid pWSGX1, complete sequence 72686-72719 7 0.794
NZ_CP013233_2 2.11|2234504|34|NZ_CP013233|CRT 2234504-2234537 34 CP052339 Klebsiella pneumoniae strain D17KP0018 plasmid unnamed 44017-44050 7 0.794
NZ_CP013233_2 2.11|2234504|34|NZ_CP013233|CRT 2234504-2234537 34 NZ_CP032224 Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence 52429-52462 7 0.794
NZ_CP013233_2 2.11|2234504|34|NZ_CP013233|CRT 2234504-2234537 34 NZ_CP027046 Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence 10608-10641 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP021942 Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence 1646-1679 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP021942 Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence 17958-17991 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP017988 Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence 1262-1295 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP017988 Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence 17577-17610 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018715 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence 58622-58655 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018715 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence 74939-74972 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018721 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-5, complete sequence 58247-58280 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018703 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-5, complete sequence 49946-49979 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP041953 Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence 46552-46585 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP028992 Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence 56767-56800 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 CP052194 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-2, complete sequence 43802-43835 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP024837 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence 59506-59539 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP008844 Klebsiella michiganensis strain M1 plasmid pKOXM1C, complete sequence 47300-47333 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP024433 Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence 1525-1558 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP032191 Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence 60296-60329 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP032191 Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence 76514-76547 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP021949 Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence 58302-58335 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP021949 Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence 74618-74651 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018688 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence 1710-1743 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018688 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence 18022-18055 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_LR025090 Klebsiella pneumoniae isolate KP980 plasmid 4, complete sequence 45475-45508 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP021760 Klebsiella pneumoniae strain AR_0138 plasmid tig00000003, complete sequence 14895-14928 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018697 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence 3643-3676 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018697 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence 19960-19993 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018709 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence 56354-56387 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018709 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence 72673-72706 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 CP038007 Klebsiella phage 020009, complete genome 46974-47007 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 MK416021 Klebsiella phage ST846-OXA48phi9.1, complete genome 31511-31544 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP023421 Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence 31960-31993 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP015504 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 4, complete sequence 9339-9372 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP009276 Klebsiella variicola strain DX120E plasmid pKV2, complete sequence 7446-7479 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP028794 Klebsiella pneumoniae strain WCHKP040035 plasmid p1_040035, complete sequence 20016-20049 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP031806 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence 22415-22448 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP009878 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852, complete sequence 6646-6679 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP031794 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed2, complete sequence 7589-7622 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP024841 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_3, complete sequence 9847-9880 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP036444 Klebsiella pneumoniae strain ABFPV plasmid tig00001255_pilon, complete sequence 37662-37695 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP050366 Klebsiella pneumoniae strain 47733 plasmid p47733L, complete sequence 8103-8136 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_LR025094 Klebsiella pneumoniae isolate KP9201 plasmid 4, complete sequence 6241-6274 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 NZ_CP018314 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-6, complete sequence 15544-15577 7 0.794
NZ_CP013233_2 2.16|2234879|34|NZ_CP013233|CRT 2234879-2234912 34 MT090961 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_54kb, complete sequence 8082-8115 7 0.794
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 287098-287131 7 0.794
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 82940-82973 7 0.794
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 NZ_CP027046 Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence 10608-10641 9 0.735
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 CP052339 Klebsiella pneumoniae strain D17KP0018 plasmid unnamed 44017-44050 9 0.735
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 NZ_CP032224 Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence 52429-52462 9 0.735
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 NZ_CP027046 Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence 10608-10641 9 0.735
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 CP052339 Klebsiella pneumoniae strain D17KP0018 plasmid unnamed 44017-44050 9 0.735
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 NZ_CP032224 Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence 52429-52462 9 0.735
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 48335-48368 9 0.735
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP028242 Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence 54758-54791 9 0.735
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 46503-46536 9 0.735
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 55165-55198 9 0.735
NZ_CP013233_2 2.18|2235029|34|NZ_CP013233|CRT 2235029-2235062 34 NZ_CP017381 Lactobacillus plantarum strain TMW 1.1623 plasmid pL11623-2, complete sequence 23455-23488 9 0.735
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 MN445185 Escherichia phage vB_EcoM_EC001, complete genome 137510-137543 10 0.706
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 KU726251 Enterobacteria phage SEGD1, complete genome 137475-137508 10 0.706
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 MT679221 Proteus phage 7, complete genome 139581-139614 10 0.706
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 NC_027402 Salmonella phage SPN3US, complete genome 138716-138749 10 0.706
NZ_CP013233_2 2.10|2234429|34|NZ_CP013233|CRT 2234429-2234462 34 MT799840 Salmonella phage JN03, complete genome 138103-138136 10 0.706
NZ_CP013233_2 2.12|2234579|34|NZ_CP013233|CRT 2234579-2234612 34 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 14443-14476 10 0.706
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 MN445185 Escherichia phage vB_EcoM_EC001, complete genome 137510-137543 10 0.706
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 KU726251 Enterobacteria phage SEGD1, complete genome 137475-137508 10 0.706
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 MT679221 Proteus phage 7, complete genome 139581-139614 10 0.706
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 NC_027402 Salmonella phage SPN3US, complete genome 138716-138749 10 0.706
NZ_CP013233_2 2.17|2234954|34|NZ_CP013233|CRT 2234954-2234987 34 MT799840 Salmonella phage JN03, complete genome 138103-138136 10 0.706
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 MN445185 Escherichia phage vB_EcoM_EC001, complete genome 137510-137543 10 0.706
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 KU726251 Enterobacteria phage SEGD1, complete genome 137475-137508 10 0.706
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 MT679221 Proteus phage 7, complete genome 139581-139614 10 0.706
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 NC_027402 Salmonella phage SPN3US, complete genome 138716-138749 10 0.706
NZ_CP013233_2 2.23|2235404|34|NZ_CP013233|CRT 2235404-2235437 34 MT799840 Salmonella phage JN03, complete genome 138103-138136 10 0.706

1. spacer 2.26|2235620|34|NZ_CP013233|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 1, identity: 0.971

ttgtccactggcctgagcaccactaacagcaacg	CRISPR spacer
ttgtccactggcctgagcacgactaacagcaacg	Protospacer
******************** *************

2. spacer 2.14|2234729|34|NZ_CP013233|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 2, identity: 0.941

ttgtccactggtctgagcaccactaacagcaacg	CRISPR spacer
ttgtccactggcctgagcacgactaacagcaacg	Protospacer
***********.******** *************

3. spacer 2.15|2234804|34|NZ_CP013233|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtccaccggcctgagcaccactaacagcaacg	CRISPR spacer
ctgtccaccggcctgagcacgacgaacagcaacg	Protospacer
******************** ** **********

4. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgtccaccggcctgagcacgacgaacagcaacg	Protospacer
******************** ** **********

5. spacer 2.5|2234054|34|NZ_CP013233|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 3, identity: 0.912

ctgtccactggcttgagcacaactaacagcaacg	CRISPR spacer
ttgtccactggcctgagcacgactaacagcaacg	Protospacer
.***********.*******.*************

6. spacer 2.15|2234804|34|NZ_CP013233|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 3, identity: 0.912

ctgtccaccggcctgagcaccactaacagcaacg	CRISPR spacer
ttgtccactggcctgagcacgactaacagcaacg	Protospacer
.*******.*********** *************

7. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ctgtctacctcggcctcgacaggca	Protospacer
.**** ********.**********

8. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

9. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

10. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

11. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to CP021182 (Sphingomonas wittichii DC-6 plasmid pDC01, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

12. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

13. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_AP018666 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_3, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

14. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NC_015595 (Sphingobium chlorophenolicum L-1 plasmid pSPHCH01, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

15. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

16. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

17. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

18. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 3, identity: 0.88

ttgtcgacctcggcttcgacaggca	CRISPR spacer
ttggcgacctcggcttcgaccggga	Protospacer
*** **************** ** *

19. spacer 1.1|472940|25|NZ_CP013233|CRISPRCasFinder matches to MN693134 (Marine virus AFVG_25M117, complete genome) position: , mismatch: 4, identity: 0.84

attttggtgcaaaaatggatgcaat	CRISPR spacer
catttggtgcaaaaatgggtgctat	Protospacer
  ****************.*** **

20. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

21. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

22. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

23. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

24. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

25. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

26. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

27. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

28. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

29. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

30. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

31. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

32. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

33. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

34. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

35. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

36. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

37. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

38. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

39. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

40. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

41. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

42. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

43. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

44. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

45. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

46. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

47. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

48. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

49. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

50. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

51. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

52. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

53. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

54. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

55. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

56. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

57. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

58. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

59. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

60. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

61. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

62. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

63. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

64. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

65. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

66. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

67. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

68. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

69. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

70. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

71. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

72. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

73. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

74. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

75. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

76. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

77. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

78. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

79. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

80. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

81. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

82. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

83. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

84. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

85. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

86. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

87. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
ctttccacgggtctgagcacgaccaacagcaacg	Protospacer
.* ** ************** *************

88. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NC_002682 (Mesorhizobium japonicum MAFF 303099 plasmid pMLb, complete sequence) position: , mismatch: 4, identity: 0.84

ttgtcgacctcggcttcgacaggca	CRISPR spacer
gcgtcgatctcggcttcgacatgca	Protospacer
 .*****.************* ***

89. spacer 2.25|2235554|25|NZ_CP013233|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

ttgtcgacctcggcttcgacaggca	CRISPR spacer
cggtcgacctcggcttcaacagtca	Protospacer
. ***************.**** **

90. spacer 1.1|472940|25|NZ_CP013233|CRISPRCasFinder matches to NZ_CP029793 (Psychrobacter sp. YP14 plasmid pYP14d, complete sequence) position: , mismatch: 5, identity: 0.8

attttggtgcaaaaatggatgcaat	CRISPR spacer
attttggtgcaaaaatggaattatc	Protospacer
*******************  .* .

91. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

92. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

93. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

94. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

95. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

96. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

97. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

98. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

99. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP052134 (Burkholderia glumae strain HN plasmid pbghn2, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacgggcctgagcacgaccaacagcacgg	Protospacer
 . ********.******** **********  *

100. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacgggcctgagcacgaccaacagcacgg	Protospacer
 . ********.******** **********  *

101. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

102. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

103. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

104. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

105. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

106. spacer 2.4|2233979|34|NZ_CP013233|CRT matches to NZ_CP045089 (Burkholderia glumae strain GX plasmid pWSGX1, complete sequence) position: , mismatch: 7, identity: 0.794

ttgtcgacgggtctgagcaccaccaacagcaacg	CRISPR spacer
acctcgacggggctgagcacgaccaacagcacgg	Protospacer
 . ******** ******** **********  *

107. spacer 2.11|2234504|34|NZ_CP013233|CRT matches to CP052339 (Klebsiella pneumoniae strain D17KP0018 plasmid unnamed) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
***.  * *.**** *.*****************

108. spacer 2.11|2234504|34|NZ_CP013233|CRT matches to NZ_CP032224 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
***.  * *.**** *.*****************

109. spacer 2.11|2234504|34|NZ_CP013233|CRT matches to NZ_CP027046 (Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
***.  * *.**** *.*****************

110. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP021942 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

111. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP021942 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000218j2847_linear, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

112. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP017988 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

113. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP017988 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

114. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018715 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

115. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018715 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

116. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018721 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

117. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018703 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

118. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP041953 (Klebsiella pneumoniae strain KP2 plasmid pKP2_7, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

119. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP028992 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

120. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to CP052194 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-2, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

121. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP024837 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_3, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

122. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP008844 (Klebsiella michiganensis strain M1 plasmid pKOXM1C, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

123. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP024433 (Klebsiella pneumoniae strain DA48896 plasmid p48896_4, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

124. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP032191 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

125. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP032191 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

126. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP021949 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

127. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP021949 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000216_u, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

128. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018688 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

129. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018688 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

130. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_LR025090 (Klebsiella pneumoniae isolate KP980 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

131. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP021760 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000003, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

132. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018697 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

133. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018697 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

134. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018709 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

135. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018709 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-5, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

136. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to CP038007 (Klebsiella phage 020009, complete genome) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

137. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to MK416021 (Klebsiella phage ST846-OXA48phi9.1, complete genome) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

138. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP023421 (Klebsiella pneumoniae strain 1050 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

139. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP015504 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 4, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

140. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP009276 (Klebsiella variicola strain DX120E plasmid pKV2, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

141. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP028794 (Klebsiella pneumoniae strain WCHKP040035 plasmid p1_040035, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

142. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP031806 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

143. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP009878 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

144. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP031794 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

145. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP024841 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_3, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

146. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP036444 (Klebsiella pneumoniae strain ABFPV plasmid tig00001255_pilon, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

147. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP050366 (Klebsiella pneumoniae strain 47733 plasmid p47733L, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

148. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_LR025094 (Klebsiella pneumoniae isolate KP9201 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

149. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to NZ_CP018314 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-6, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

150. spacer 2.16|2234879|34|NZ_CP013233|CRT matches to MT090961 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_54kb, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccaccggcctgagcaccaccaacagcaacg	CRISPR spacer
ctgcagaacagcctgaacaccaccaacaacaacg	Protospacer
***.  * *.******.***********.*****

151. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccactggcctgagcaccaccaacagtaact--	CRISPR spacer
ctgcccactggcctgaacaccacc--ccgcacctct	Protospacer
***.************.*******  * *.* **  

152. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 7, identity: 0.794

ctgtccactggcctgagcaccaccaacagtaact--	CRISPR spacer
ctgcccactggcctgaacaccacc--ccgcacctct	Protospacer
***.************.*******  * *.* **  

153. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to NZ_CP027046 (Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
.**.  * ..**** *.*****************

154. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to CP052339 (Klebsiella pneumoniae strain D17KP0018 plasmid unnamed) position: , mismatch: 9, identity: 0.735

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
.**.  * ..**** *.*****************

155. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to NZ_CP032224 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
.**.  * ..**** *.*****************

156. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to NZ_CP027046 (Klebsiella pneumoniae strain 1_GR_13 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
.**.  * ..**** *.*****************

157. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to CP052339 (Klebsiella pneumoniae strain D17KP0018 plasmid unnamed) position: , mismatch: 9, identity: 0.735

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
.**.  * ..**** *.*****************

158. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to NZ_CP032224 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
ctgcagaacagcctcaacaccaccaacagtaacg	Protospacer
.**.  * ..**** *.*****************

159. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 9, identity: 0.735

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
cattcgactggtttcagcaccatcaacttctctg	Protospacer
*  *********** *******.****  *  .*

160. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to NZ_CP028242 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
cattcgactggtttcagcaccatcaacttctctg	Protospacer
*  *********** *******.****  *  .*

161. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 9, identity: 0.735

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
cattcgactggtttcagcaccatcaacttctctg	Protospacer
*  *********** *******.****  *  .*

162. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 9, identity: 0.735

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
cattcgactggtttcagcaccatcaacttctctg	Protospacer
*  *********** *******.****  *  .*

163. spacer 2.18|2235029|34|NZ_CP013233|CRT matches to NZ_CP017381 (Lactobacillus plantarum strain TMW 1.1623 plasmid pL11623-2, complete sequence) position: , mismatch: 9, identity: 0.735

ctgtcgactggtttgagcaccaccaacagcaacg	CRISPR spacer
cattcgactggtttcagcaccatcaacttctctg	Protospacer
*  *********** *******.****  *  .*

164. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to MN445185 (Escherichia phage vB_EcoM_EC001, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

165. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to KU726251 (Enterobacteria phage SEGD1, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

166. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to MT679221 (Proteus phage 7, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

167. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to NC_027402 (Salmonella phage SPN3US, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

168. spacer 2.10|2234429|34|NZ_CP013233|CRT matches to MT799840 (Salmonella phage JN03, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

169. spacer 2.12|2234579|34|NZ_CP013233|CRT matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 10, identity: 0.706

ctgtccacaggcctgagcacaaccaacagtaacg	CRISPR spacer
acgggcacaggcatgagcccaaccaacagcctgg	Protospacer
 .*  ******* ***** **********.   *

170. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to MN445185 (Escherichia phage vB_EcoM_EC001, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

171. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to KU726251 (Enterobacteria phage SEGD1, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

172. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to MT679221 (Proteus phage 7, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

173. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to NC_027402 (Salmonella phage SPN3US, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

174. spacer 2.17|2234954|34|NZ_CP013233|CRT matches to MT799840 (Salmonella phage JN03, complete genome) position: , mismatch: 10, identity: 0.706

ttgtccactggcctgagcaccaccaacagtaacg	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.*  

175. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to MN445185 (Escherichia phage vB_EcoM_EC001, complete genome) position: , mismatch: 10, identity: 0.706

ctgtccactggcctgagcaccaccaacagtaact	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.* .

176. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to KU726251 (Enterobacteria phage SEGD1, complete genome) position: , mismatch: 10, identity: 0.706

ctgtccactggcctgagcaccaccaacagtaact	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.* .

177. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to MT679221 (Proteus phage 7, complete genome) position: , mismatch: 10, identity: 0.706

ctgtccactggcctgagcaccaccaacagtaact	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.* .

178. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to NC_027402 (Salmonella phage SPN3US, complete genome) position: , mismatch: 10, identity: 0.706

ctgtccactggcctgagcaccaccaacagtaact	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.* .

179. spacer 2.23|2235404|34|NZ_CP013233|CRT matches to MT799840 (Salmonella phage JN03, complete genome) position: , mismatch: 10, identity: 0.706

ctgtccactggcctgagcaccaccaacagtaact	CRISPR spacer
gttaaaactgacctgagcaccaccaacggtgaac	Protospacer
 *    ****.****************.**.* .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1115306 : 1177123 48 uncultured_Mediterranean_phage(11.76%) integrase,protease,tRNA attL 1113138:1113154|attR 1119126:1119142
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage