Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013236 Collimonas pratensis strain Ter291, complete genome 3 crisprs WYL,cas3,csa3,DEDDh,DinG 1 2 7 0

Results visualization

1. NZ_CP013236
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013236_1 1662757-1662954 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013236_2 3085728-3085923 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013236_3 4345442-4345542 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP013236.1 3085924-3085943 1 0.95
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP013236.1 3656887-3656906 2 0.9
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP013236.1 246549-246568 2 0.9
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP013236.1 759935-759954 2 0.9
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP013236.1 3020369-3020388 2 0.9

1. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to position: 3085924-3085943, mismatch: 1, identity: 0.95

agcgccgccagccgcaccgg	CRISPR spacer
agcgccgccagctgcaccgg	Protospacer
************.*******

2. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to position: 3656887-3656906, mismatch: 2, identity: 0.9

agcgccgccagccgcaccgg	CRISPR spacer
agcgccgccagccgctcggg	Protospacer
*************** * **

3. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to position: 246549-246568, mismatch: 2, identity: 0.9

agcgccgccagccgcaccgg	CRISPR spacer
agcgccgccagcagcagcgg	Protospacer
************ *** ***

4. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to position: 759935-759954, mismatch: 2, identity: 0.9

agcgccgccagccgcaccgg	CRISPR spacer
agcgccgccaggtgcaccgg	Protospacer
*********** .*******

5. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to position: 3020369-3020388, mismatch: 2, identity: 0.9

agcgccgccagccgcaccgg	CRISPR spacer
agcgcagccagcagcaccgg	Protospacer
***** ****** *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 678597-678616 1 0.95
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 126489-126508 1 0.95
NZ_CP013236_2 2.2|3085855|20|NZ_CP013236|PILER-CR 3085855-3085874 20 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 358795-358814 1 0.95
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 317317-317339 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1125587-1125609 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 576432-576454 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP020447 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence 63679-63701 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1236645-1236667 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 687547-687569 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 123110-123132 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP020949 Rhizobium sp. CIAT894 plasmid pRheCIAT894b, complete sequence 68659-68681 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 121343-121365 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 MN038176 Bacillus phage Phireball, complete genome 50961-50983 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 KJ489399 Bacillus phage Hakuna, complete genome 50036-50058 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 KX349902 Bacillus phage Kida, complete genome 50731-50753 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 MF288917 Bacillus phage PPIsBest, complete genome 51282-51304 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 MN038179 Bacillus phage ALPS, complete genome 50922-50944 2 0.913
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1227825-1227847 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1247840-1247862 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 662914-662936 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 414445-414467 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1425197-1425219 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1258435-1258457 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 983157-983179 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1630948-1630970 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 581923-581945 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 244607-244629 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP048631 Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence 39543-39565 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 554857-554879 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1497790-1497812 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 547055-547077 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 547055-547077 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1422209-1422231 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1404745-1404767 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1478357-1478379 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1344651-1344673 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 2008942-2008964 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1478985-1479007 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1483269-1483291 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5835592-5835614 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1658175-1658197 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1223398-1223420 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1784103-1784125 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1403097-1403119 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 482773-482795 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1921319-1921341 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1486435-1486457 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1406861-1406883 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1196092-1196114 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1410974-1410996 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1448090-1448112 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1343673-1343695 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1389047-1389069 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1389038-1389060 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1407702-1407724 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1586507-1586529 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1344643-1344665 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1343996-1344018 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1344634-1344656 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1373190-1373212 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1497916-1497938 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1586474-1586496 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1463462-1463484 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1496304-1496326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1585268-1585290 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1397060-1397082 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1463462-1463484 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1496304-1496326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1585304-1585326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1463462-1463484 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1422354-1422376 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1397082-1397104 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1462665-1462687 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1496304-1496326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1496304-1496326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1496304-1496326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1585304-1585326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1585293-1585315 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1397082-1397104 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1404034-1404056 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1422336-1422358 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1384687-1384709 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1437943-1437965 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1476821-1476843 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1493619-1493641 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1585293-1585315 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1397082-1397104 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1463461-1463483 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1586294-1586316 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1397082-1397104 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1397082-1397104 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1585304-1585326 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1496307-1496329 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1585315-1585337 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1585116-1585138 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1422321-1422343 3 0.87
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1396944-1396966 4 0.826
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1650479-1650501 4 0.826
NZ_CP013236_2 2.1|3085780|23|NZ_CP013236|PILER-CR 3085780-3085802 23 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 71892-71914 4 0.826

1. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.95

agcgccgccagccgcaccgg	CRISPR spacer
ggcgccgccagccgcaccgg	Protospacer
.*******************

2. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 1, identity: 0.95

agcgccgccagccgcaccgg	CRISPR spacer
agcgccgccagccgcaccgc	Protospacer
******************* 

3. spacer 2.2|3085855|20|NZ_CP013236|PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.95

agcgccgccagccgcaccgg	CRISPR spacer
agcgccgccagccgcaccgc	Protospacer
******************* 

4. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgccgccgccagcaccag	Protospacer
************* * *******

5. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgccaccggcggcaccag	Protospacer
*********.***** *******

6. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgccaccggcggcaccag	Protospacer
*********.***** *******

7. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgccgccggctggacgag	Protospacer
***************** ** **

8. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgccaccggcggcaccag	Protospacer
*********.***** *******

9. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgccaccggcggcaccag	Protospacer
*********.***** *******

10. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgcctccggctgcaccgg	Protospacer
********* ***********.*

11. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP020949 (Rhizobium sp. CIAT894 plasmid pRheCIAT894b, complete sequence) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
agcagcgccgccggatgcaccag	Protospacer
* ************ ********

12. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcgcctccggctgcaccgg	Protospacer
********* ***********.*

13. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to MN038176 (Bacillus phage Phireball, complete genome) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcggcgcccgctgcaccag	Protospacer
******* **** **********

14. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to KJ489399 (Bacillus phage Hakuna, complete genome) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcggcgcccgctgcaccag	Protospacer
******* **** **********

15. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to KX349902 (Bacillus phage Kida, complete genome) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcggcgcccgctgcaccag	Protospacer
******* **** **********

16. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to MF288917 (Bacillus phage PPIsBest, complete genome) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcggcgcccgctgcaccag	Protospacer
******* **** **********

17. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to MN038179 (Bacillus phage ALPS, complete genome) position: , mismatch: 2, identity: 0.913

accagcgccgccggctgcaccag	CRISPR spacer
accagcggcgcccgctgcaccag	Protospacer
******* **** **********

18. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

19. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

20. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

21. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

22. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

23. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

24. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

25. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

26. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

27. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
gccatcgccgccggctgcaccac	Protospacer
.*** ***************** 

28. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
gccagcgccgccggctccaccat	Protospacer
.*************** ***** 

29. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

30. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

31. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

32. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

33. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

34. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

35. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

36. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

37. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

38. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

39. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

40. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccgcctgcaccag	Protospacer
. *********** *********

41. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

42. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

43. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

44. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

45. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

46. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

47. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

48. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

49. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

50. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

51. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

52. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

53. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

54. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

55. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

56. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

57. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

58. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

59. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

60. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

61. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

62. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

63. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

64. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

65. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

66. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

67. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

68. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

69. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

70. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

71. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

72. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

73. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

74. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

75. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

76. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

77. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

78. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

79. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

80. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

81. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

82. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

83. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

84. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

85. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

86. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

87. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

88. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

89. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

90. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

91. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

92. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

93. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

94. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

95. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

96. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87

accagcgccgccggctgcaccag	CRISPR spacer
ggcagcgccgccggcggcaccag	Protospacer
. ************* *******

97. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.826

accagcgccgccggctgcaccag	CRISPR spacer
gggagcgccgccggctgcaccac	Protospacer
.  ******************* 

98. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.826

accagcgccgccggctgcaccag	CRISPR spacer
gggagcgccgccggctgcaccac	Protospacer
.  ******************* 

99. spacer 2.1|3085780|23|NZ_CP013236|PILER-CR matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.826

accagcgccgccggctgcaccag	CRISPR spacer
gccagcgccgccggctgcacgcc	Protospacer
.*******************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 912241 : 922333 9 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_2 1129236 : 1236000 116 Burkholderia_phage(48.15%) head,capsid,plate,tail,tRNA,portal,integrase,holin,terminase attL 1189923:1189939|attR 1243768:1243784
DBSCAN-SWA_3 1239524 : 1292355 54 Burkholderia_phage(23.33%) transposase,plate,tail,tRNA,protease,integrase attL 1250563:1250579|attR 1279543:1279559
DBSCAN-SWA_4 1498620 : 1548434 55 Pseudomonas_phage(15.0%) transposase,plate,tail,tRNA,integrase attL 1501514:1501530|attR 1523271:1523287
DBSCAN-SWA_5 2238563 : 2248972 10 Bathycoccus_sp._RCC1105_virus(12.5%) integrase,transposase attL 2244340:2244354|attR 2247352:2247366
DBSCAN-SWA_6 3032303 : 3039020 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_7 3368080 : 3446802 89 Burkholderia_virus(21.43%) head,capsid,tail,tRNA,protease,portal,integrase,terminase,coat attL 3386531:3386553|attR 3446829:3446851
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage