1. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to MK764437 (Flavobacterium phage FPSV-D15, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
2. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to MK764440 (Flavobacterium phage FPSV-F7, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
3. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to NC_041859 (Flavobacterium phage 23T, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
4. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to KU599889 (Flavobacterium phage 1H, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
5. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to NC_031926 (Flavobacterium phage 2A, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
6. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to MK764450 (Flavobacterium phage FPSV-D35, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
7. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to KC959568 (Flavobacterium phage 6H, complete genome) position: , mismatch: 1, identity: 0.966
gttaaaaggattttgctttgcgattggga CRISPR spacer
gttaaaaggattttgctttgtgattggga Protospacer
********************.********
8. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 2, identity: 0.931
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagttttagc Protospacer
*.**************.************
9. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to MH107028 (Campylobacter phage CP39, partial genome) position: , mismatch: 2, identity: 0.931
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagttttagc Protospacer
*.**************.************
10. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.931
gttttgatggaaatacaagtagttttagc CRISPR spacer
gttttgatggtaatacaactagttttagc Protospacer
********** ******* **********
11. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to NC_041859 (Flavobacterium phage 23T, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
12. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to KU599889 (Flavobacterium phage 1H, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
13. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to NC_031926 (Flavobacterium phage 2A, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
14. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to MK764450 (Flavobacterium phage FPSV-D35, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
15. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to KC959568 (Flavobacterium phage 6H, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
16. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to MK764437 (Flavobacterium phage FPSV-D15, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
17. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to MK764440 (Flavobacterium phage FPSV-F7, complete genome) position: , mismatch: 2, identity: 0.933
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
gttaaaaggattttgctttgtgattgggag Protospacer
********************.********.
18. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to MH107028 (Campylobacter phage CP39, partial genome) position: , mismatch: 2, identity: 0.933
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagttttagca Protospacer
*.**************.*************
19. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.933
gttttgatggaaatacaagtagttttagca CRISPR spacer
gttttgatggtaatacaactagttttagca Protospacer
********** ******* ***********
20. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 2, identity: 0.933
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagttttagca Protospacer
*.**************.*************
21. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to NC_042112 (Campylobacter phage CP81, complete genome) position: , mismatch: 4, identity: 0.862
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagctttagt Protospacer
*.**************.*****.*****.
22. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 4, identity: 0.862
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagctttagt Protospacer
*.**************.*****.*****.
23. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to KF148616 (Campylobacter phage CP8, complete genome) position: , mismatch: 4, identity: 0.862
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagctttagt Protospacer
*.**************.*****.*****.
24. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to NC_016562 (Campylobacter phage CPX, complete genome) position: , mismatch: 4, identity: 0.862
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagctttagt Protospacer
*.**************.*****.*****.
25. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 4, identity: 0.862
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagctttagt Protospacer
*.**************.*****.*****.
26. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to JX569801 (Campylobacter phage CP30A, complete genome) position: , mismatch: 4, identity: 0.862
gttttgatggaaatacaagtagttttagc CRISPR spacer
gctttgatggaaatacgagtagctttagt Protospacer
*.**************.*****.*****.
27. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 4, identity: 0.867
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagctttagta Protospacer
*.**************.*****.*****.*
28. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to KF148616 (Campylobacter phage CP8, complete genome) position: , mismatch: 4, identity: 0.867
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagctttagta Protospacer
*.**************.*****.*****.*
29. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to NC_016562 (Campylobacter phage CPX, complete genome) position: , mismatch: 4, identity: 0.867
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagctttagta Protospacer
*.**************.*****.*****.*
30. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 4, identity: 0.867
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagctttagta Protospacer
*.**************.*****.*****.*
31. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to JX569801 (Campylobacter phage CP30A, complete genome) position: , mismatch: 4, identity: 0.867
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagctttagta Protospacer
*.**************.*****.*****.*
32. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to NC_042112 (Campylobacter phage CP81, complete genome) position: , mismatch: 4, identity: 0.867
gttttgatggaaatacaagtagttttagca CRISPR spacer
gctttgatggaaatacgagtagctttagta Protospacer
*.**************.*****.*****.*
33. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to KX879627 (Campylobacter phage vB_CjeM_Los1, complete genome) position: , mismatch: 5, identity: 0.828
gttttgatggaaatacaagtagttttagc CRISPR spacer
actttgatggaaatacgagtagctttagt Protospacer
..**************.*****.*****.
34. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to KX879627 (Campylobacter phage vB_CjeM_Los1, complete genome) position: , mismatch: 5, identity: 0.833
gttttgatggaaatacaagtagttttagca CRISPR spacer
actttgatggaaatacgagtagctttagta Protospacer
..**************.*****.*****.*
35. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to GU071097 (Synechococcus phage S-SSM5, complete genome) position: , mismatch: 6, identity: 0.793
aaaatatcgatgatagaatggcttctact CRISPR spacer
tcaaggtcggtgatagaattgcttctact Protospacer
** .***.********* *********
36. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to AP014494 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C46-MedDCM-OCT-S46-C77, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 7, identity: 0.759
gttaaaaggattttgctttgcgattggga CRISPR spacer
ttcaaaaggatttttctttgccattgccg Protospacer
*.*********** ****** **** .
37. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
aaaatattgatgatagaatggagttgatc Protospacer
*******.************* *. *..
38. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979239 (Flavobacterium phage V156, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
39. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
40. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
41. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
42. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
43. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
44. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
45. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
46. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
47. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
48. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
49. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
50. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
51. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
52. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
53. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
54. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
55. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
56. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
57. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
58. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
59. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
60. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
61. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
62. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756091 (Flavobacterium phage FCOV-F45, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
63. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
64. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
65. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
66. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
67. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
68. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
69. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
70. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
71. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
72. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
73. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756087 (Flavobacterium phage FCOV-F16, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
74. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
75. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
76. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KM873719 (Flavobacterium phage FCL-2, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
77. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
78. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
79. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
80. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
81. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
82. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
83. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
84. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
85. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979240 (Flavobacterium phage V157, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
86. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
87. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
88. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585282 (Flavobacterium phage FCOV-F15, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
89. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
90. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979247 (Flavobacterium phage VK58, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
91. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
92. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
93. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756086 (Flavobacterium phage FCOV-F13, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
94. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
95. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756093 (Flavobacterium phage FCOV-F54, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
96. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
97. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
98. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756092 (Flavobacterium phage FCOV-F46, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
99. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756096 (Flavobacterium phage V186, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
100. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
101. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585310 (Flavobacterium phage FCOV-F56, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
102. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
103. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
104. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585281 (Flavobacterium phage FCOV-F14, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
105. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
106. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
107. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756094 (Flavobacterium phage FCOV-S1, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
108. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
109. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
110. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
111. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
112. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
113. spacer 2.3|1489249|29|NZ_CP014744|CRISPRCasFinder matches to MK756095 (Flavobacterium phage FCOV-S2, complete genome) position: , mismatch: 7, identity: 0.759
aaaatatcgatgatagaatggcttctact CRISPR spacer
agccaatagaggatagaatggcttctacc Protospacer
*. ** ** *****************.
114. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
aaaatattgatgatagaatggagttgatca Protospacer
*******.************* *. *..*
115. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979239 (Flavobacterium phage V156, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
116. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
117. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
118. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
119. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
120. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
121. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
122. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
123. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
124. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
125. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
126. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
127. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
128. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
129. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
130. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
131. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
132. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
133. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
134. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
135. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
136. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
137. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
138. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
139. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756091 (Flavobacterium phage FCOV-F45, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
140. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
141. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
142. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
143. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
144. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
145. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
146. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
147. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to GU071097 (Synechococcus phage S-SSM5, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
tcaaggtcggtgatagaattgcttctactg Protospacer
** .***.********* *********.
148. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
149. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
150. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
151. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756087 (Flavobacterium phage FCOV-F16, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
152. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
153. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
154. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KM873719 (Flavobacterium phage FCL-2, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
155. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
156. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
157. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
158. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
159. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
160. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
161. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
162. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
163. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979240 (Flavobacterium phage V157, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
164. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
165. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
166. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585282 (Flavobacterium phage FCOV-F15, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
167. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
168. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979247 (Flavobacterium phage VK58, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
169. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
170. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
171. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756086 (Flavobacterium phage FCOV-F13, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
172. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
173. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756093 (Flavobacterium phage FCOV-F54, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
174. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
175. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
176. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756092 (Flavobacterium phage FCOV-F46, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
177. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756096 (Flavobacterium phage V186, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
178. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
179. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585310 (Flavobacterium phage FCOV-F56, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
180. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
181. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
182. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585281 (Flavobacterium phage FCOV-F14, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
183. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
184. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
185. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756094 (Flavobacterium phage FCOV-S1, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
186. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
187. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
188. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
189. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
190. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
191. spacer 2.9|1489249|30|NZ_CP014744|CRT matches to MK756095 (Flavobacterium phage FCOV-S2, complete genome) position: , mismatch: 7, identity: 0.767
aaaatatcgatgatagaatggcttctacta CRISPR spacer
agccaatagaggatagaatggcttctacca Protospacer
*. ** ** *****************.*
192. spacer 2.2|1489183|29|NZ_CP014744|CRISPRCasFinder matches to MN693357 (Marine virus AFVG_25M390, complete genome) position: , mismatch: 8, identity: 0.724
gttaaaaggattttgctttgcgattggga CRISPR spacer
agtaaaaggtttttgctttgctattttac Protospacer
. ******* *********** *** .
193. spacer 2.5|1489381|29|NZ_CP014744|CRISPRCasFinder,PILER-CR matches to NZ_CP022984 (Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence) position: , mismatch: 8, identity: 0.724
gttttgatggaaatacaagtagttttagc CRISPR spacer
cgaatgatggaaatacgagtagttatatt Protospacer
************.******* ** .
194. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to AP014494 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C46-MedDCM-OCT-S46-C77, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 8, identity: 0.733
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
ttcaaaaggatttttctttgccattgccgc Protospacer
*.*********** ****** **** .
195. spacer 2.10|1489315|30|NZ_CP014744|CRT matches to AC171169 (Escherichia virus H8 clone h8_phage, WORKING DRAFT SEQUENCE) position: , mismatch: 8, identity: 0.733
tttgtgccttttattactgctatggtagct CRISPR spacer
aataactcgtttattactgctattgtagct Protospacer
*. .* ************** ******
196. spacer 2.10|1489315|30|NZ_CP014744|CRT matches to NC_042307 (Escherichia virus H8, complete genome, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
tttgtgccttttattactgctatggtagct CRISPR spacer
aataactcgtttattactgctattgtagct Protospacer
*. .* ************** ******
197. spacer 2.11|1489381|30|NZ_CP014744|CRT matches to NZ_CP022984 (Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence) position: , mismatch: 8, identity: 0.733
gttttgatggaaatacaagtagttttagca CRISPR spacer
cgaatgatggaaatacgagtagttatatta Protospacer
************.******* ** .*
198. spacer 2.8|1489183|30|NZ_CP014744|CRT matches to MN693357 (Marine virus AFVG_25M390, complete genome) position: , mismatch: 9, identity: 0.7
gttaaaaggattttgctttgcgattgggaa CRISPR spacer
agtaaaaggtttttgctttgctattttact Protospacer
. ******* *********** *** .