Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014991 Helicobacter himalayensis strain YS1, complete genome 6 crisprs cas3 3 1 0 0

Results visualization

1. NZ_CP014991
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014991_1 776086-776169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014991_3 1340438-1340520 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014991_2 1340177-1340264 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014991_4 1372758-1372845 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014991_5 1373019-1373105 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014991_6 1744318-1744439 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014991_2 2.1|1340204|33|NZ_CP014991|CRISPRCasFinder 1340204-1340236 33 NZ_CP014991.1 1370295-1370327 0 1.0
NZ_CP014991_4 4.1|1372785|33|NZ_CP014991|CRISPRCasFinder 1372785-1372817 33 NZ_CP014991.1 1370295-1370327 0 1.0
NZ_CP014991_5 5.1|1373046|33|NZ_CP014991|CRISPRCasFinder 1373046-1373078 33 NZ_CP014991.1 1370033-1370065 0 1.0

1. spacer 2.1|1340204|33|NZ_CP014991|CRISPRCasFinder matches to position: 1370295-1370327, mismatch: 0, identity: 1.0

ccaccctaaataacaacaatagcgctacactcg	CRISPR spacer
ccaccctaaataacaacaatagcgctacactcg	Protospacer
*********************************

2. spacer 4.1|1372785|33|NZ_CP014991|CRISPRCasFinder matches to position: 1370295-1370327, mismatch: 0, identity: 1.0

ccaccctaaataacaacaatagcgctacactcg	CRISPR spacer
ccaccctaaataacaacaatagcgctacactcg	Protospacer
*********************************

3. spacer 5.1|1373046|33|NZ_CP014991|CRISPRCasFinder matches to position: 1370033-1370065, mismatch: 0, identity: 1.0

caacccttaccaaccaaacaaatggacaaatag	CRISPR spacer
caacccttaccaaccaaacaaatggacaaatag	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014991_3 3.1|1340465|29|NZ_CP014991|CRISPRCasFinder 1340465-1340493 29 MT325768 Psychrobacillus phage Perkons, complete genome 91601-91629 7 0.759

1. spacer 3.1|1340465|29|NZ_CP014991|CRISPRCasFinder matches to MT325768 (Psychrobacillus phage Perkons, complete genome) position: , mismatch: 7, identity: 0.759

caacccttaccaaacaaatggacgcatag	CRISPR spacer
gcggctttaccaaacaaaggtacgcatag	Protospacer
  . *.************ * ********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage