Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014950 Mycobacteroides abscessus strain FLAC003 chromosome, complete genome 1 crisprs cas3,csa3,DinG,DEDDh,cas4,WYL 0 1 3 0

Results visualization

1. NZ_CP014950
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014950_1 883100-883187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014950_1 1.1|883131|26|NZ_CP014950|CRISPRCasFinder 883131-883156 26 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 6463-6488 5 0.808
NZ_CP014950_1 1.1|883131|26|NZ_CP014950|CRISPRCasFinder 883131-883156 26 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 213898-213923 5 0.808
NZ_CP014950_1 1.1|883131|26|NZ_CP014950|CRISPRCasFinder 883131-883156 26 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 669429-669454 5 0.808

1. spacer 1.1|883131|26|NZ_CP014950|CRISPRCasFinder matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggcggttggggcca	CRISPR spacer
caccccggccagggcggcgggggcgg	Protospacer
 ****************. ***** .

2. spacer 1.1|883131|26|NZ_CP014950|CRISPRCasFinder matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggcggttggggcca	CRISPR spacer
caccccggccagggcggcgggggcgg	Protospacer
 ****************. ***** .

3. spacer 1.1|883131|26|NZ_CP014950|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggcggttggggcca	CRISPR spacer
tggcgcggccagggcggttgaggcca	Protospacer
 . * ***************.*****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1706443 : 1711857 8 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_2 1715396 : 1765309 61 Mycobacterium_phage(77.27%) portal,capsid,tail NA
DBSCAN-SWA_3 3976856 : 3986350 8 Burkholderia_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage