Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014954 Mycobacteroides abscessus strain FLAC008 chromosome, complete genome 1 crisprs cas3,csa3,DinG,DEDDh,cas4,WYL 0 1 7 0

Results visualization

1. NZ_CP014954
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014954_1 991669-991756 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014954_1 1.1|991700|26|NZ_CP014954|CRISPRCasFinder 991700-991725 26 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 418376-418401 5 0.808
NZ_CP014954_1 1.1|991700|26|NZ_CP014954|CRISPRCasFinder 991700-991725 26 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 678153-678178 5 0.808
NZ_CP014954_1 1.1|991700|26|NZ_CP014954|CRISPRCasFinder 991700-991725 26 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 54049-54074 6 0.769
NZ_CP014954_1 1.1|991700|26|NZ_CP014954|CRISPRCasFinder 991700-991725 26 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 143457-143482 6 0.769

1. spacer 1.1|991700|26|NZ_CP014954|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggtggttggggcca	CRISPR spacer
gaccccggccagggtggtcgcggcgg	Protospacer
.*****************.* *** .

2. spacer 1.1|991700|26|NZ_CP014954|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggtggttggggcca	CRISPR spacer
gaccccggccagggtggtcgcggcgg	Protospacer
.*****************.* *** .

3. spacer 1.1|991700|26|NZ_CP014954|CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 6, identity: 0.769

aaccccggccagggtggttggggcca	CRISPR spacer
ttgcccggcgagggtggttggggcac	Protospacer
   ****** **************  

4. spacer 1.1|991700|26|NZ_CP014954|CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 6, identity: 0.769

aaccccggccagggtggttggggcca	CRISPR spacer
ttgcccggcgagggtggttggggcac	Protospacer
   ****** **************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 413523 : 475243 55 Gordonia_phage(28.57%) integrase,protease,holin attL 473909:473923|attR 475261:475275
DBSCAN-SWA_2 522702 : 564896 62 Mycobacterium_phage(48.39%) capsid,tail,portal,integrase,terminase attL 522641:522656|attR 565314:565329
DBSCAN-SWA_3 1733968 : 1742166 11 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_4 1750840 : 1780515 29 Mycobacterium_phage(59.09%) integrase,terminase,portal attL 1778484:1778498|attR 1785142:1785156
DBSCAN-SWA_5 2868083 : 2876644 7 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_6 4364845 : 4374344 9 Burkholderia_phage(25.0%) NA NA
DBSCAN-SWA_7 5081442 : 5089814 8 Mycobacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage